[Back to the SolCAP Project Website]

Tomato SNP: OPA Design Information


Tomato SNP OPA Design Data
download

SNP_name Sequence Genome_Build_Version Chr Coordinate Source dbSNP_version Ploidy Species Cust_Strand
SC_S_Sl_00001 TATCATAATATATTTTTTGAATTTTGATTGTTTGATGGCCCTGTAAAGTAGTTGTGACTT[A/C]ATAGAATGGATTTTTTTTTCAAAATTCCTATGATTGTGTAGTTCTGAGTTACATTTTCCA 0 2 22364 AC215381 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00002 TGGAAATTACTTCGTTGTGGATGAGTTAATTCCTTTTAAGTTAATTCTATAGTAGGAGTA[T/G]TTGTGGAGAGCCACTTTGTTTCTTTTAAATCGTGATGTAAATGTTTCAATCTATGGAGAT 0 4 91875 CU459062 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00003 GGATGCCGTTCTTATTTTTTGTGTTGCATTTCAACATCTGTGTACTTGGTACTATTTTAC[A/C]TACCTTTTTTTGTCAGGAAAAAAGAAAGACTCAGTTGAGATCAATCAGTTGCCTTTTATG 0 2 55381 AC226520 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00004 GCCAAGGCAAAAACAGAATGAAATCTCGATCAATTTTGATGGTAGATTATAATCATTAGA[T/C]GGATGAACCAAAACTTTGGTTGTATTGTAGGCAGGATCTTCTTTTAGTCTGTTGTGTCAT 0 3 52992 EU124737 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00005 TTTCTATTTCTGCTATATTGAATTATTGAGTTCTTTTGTCAATGTGCAGCAATTAGAAGA[T/C]GAGGATGAGTTTGTTGCACTGTTAAGGGCCACCATAAAAGGTCTTGTCTACCCCGAGCAC 0 4 53912 CU326399 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00006 ACAAATAGTTTTATTTTTTTTTGTTTTACAAAGCTGGCGATCGATAATCAAGACACCACT[T/G]TTCGTGAATTCAAGCCTAAGAATAGGCGAATCATGGTAAATTTTTGTTTAAAAATGGAGA 0 8 94104 AP010652 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00007 ATATCTGCTTGAAGGGGTTTTGAATCCCTACTGATGCTTTCAGATCAAGATTGTGCTACA[A/C]ATTCCAAGTACGAATCAAATGCCATCTCTAAGAATGAAGACAAAGCTAGCCACATCCAGT 0 2 51192 AC215374 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00008 CATCAATGATGGCAGTCAATCAGTTGCCATCTCTCTGCAAGCAGAACATATGAAACTTTT[T/C]GAGAAGTTCTTGTATGACATTTGAAAGAAGCCGCTTTCTTGTGCTGCTTTGATTGGGATT 0 3 94597 EU124731 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00009 ATATTCTGTGTTGTTAATTAATCTTCTTCTTCTTCTTCTTTTTTTCAGATGAGAAAGGAT[T/C]AGAGAGTATGCTTAGTTTCATTGAGAAGGTGCAAGAAGAGATTAACAAGTGATCAAGTTT 0 4 139341 CU928132 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00010 GGTGAACAACATGGTTTTGTTCGATAAGGGTACATACGACAAGCTTATCACTGAAGCACC[T/C]AAGTATAAGCTTATCACTCCTTCCGTCCTCTCTGACCGTTTGAGGGTATGTGTATTCTTT 0 2 42494 AC215429 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00011 GTAAGTGCAATTCAATAACCGGGTCGGTGACAGGTGTATCCGACCCACTCCAGAAGAGCT[A/G]GAGGATTTTGGTACTCCGGACTTCACAATTTACAATGCTGGTCAATTCCCATGTAACCGT 0 4 29184 CU856536 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00012 GGAAATCTGTTGCAAATTTCCTTGTAGAGAAAACGAATGGTGATCCTCTTGCAAAAGCAG[T/C]GAGCCAATGTGTAATGTATTCAATGCTGGTCTCCATGGATGTCATTGTATATGGTTCCGT 0 4 159373 CU928132 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00013 TTGTGAAGAATGTGATTTGTTTCACTTGCCTTGGCCCAAGTCATGTGTGCGAGGTTTACT[A/T]AGTGGAAATAATTTTCATTTATCGGACAACTGACAAACTGGCGCAGACCAAAGGGTATTG 0 2 26033 AC215375 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00014 ATTTATTGCAGGTCCTAGCAAACCATCTAAAAAGAAATCGAAGAGCTCTAGATAAGTAGT[A/T]GTCTCTTGGGAAAAGGTTGCTATTGGCCATTTGTGATTATGATTGCTGAAGAAAGTCTGT 0 2 30949 AC215362 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00015 TTATTCTATGTATTTGAATGCAGGAGGAAGTGGTTTTAAATCTCTAAAGAATTATCGTTC[T/C]GGTTATTTTGGGAGTAGTATTAAGCTACAACCTGGTTTTACTGCTGGAATTATTACTTCT 0 11 16229 AC220059 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00016 GTTCAATTATTTTTATATGACTAATGGTAGGTTTAGAAGGGCAGAATCAGGGAGACCTTA[T/C]ATTAAATGTAATGATTGTGGTGCTAGGTTTATTGAAGCACAATGTGATAAAACTTTGGAT 0 9 42693 EF647605 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00017 ACAGGAAATCTCGAGTAAAAAAAGTGATCAGAGTTCCGGCGATCAGTTCAAAAACTGCTG[A/G]TATTCCGGCAGATGAATACTCATGGAGAAAGTACGGTCAAAAGCCGATCAAAGGTTCACC 0 8 54905 AP009283 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00018 TAATTTTTCTTCCATTTATTTTATTTTTTTGGCAGAATTTGCATGACATTCTGTTGAAAA[A/G]AGGACCTCAAGCTCACTTTTTTGTGCTTCTTCTTCTTCTTCTTCCGTTTCTCGTCAGGTA 0 4 103272 CU459062 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00019 GAAGTGTGTTGCAGTTGCTAGCAAACATCCAGTGTATGAGCTTGGTGCTGCTGACTTGGT[T/C]GTGAGGCACCTTGATGAGCTCTCGATCGTTGACCTAAAGAACCTTGCTGCTGTTGAGCTG 0 8 96120 AP009287 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00020 GGTTGTGTGCAGCTTTAGGACCTTTAGACTCTGATGAATGGGATCATGTTTTGCTTACTT[T/C]ATATTGAACTTAATCGCTAATATTACTTTTTGAAAGTCATTATGTTCTTCATTTTTAATT 0 12 104262 AC209585 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00021 TCTGAAGTCATCCAGAACTTCCTTTTTTGCCTTCTCCTATGTTGCACTGTTGAATTTTAG[A/T]TATTATGGATGTTTATTTTGTGTTACATTGTCTTTCAATAGATGATTTTGTGTTATGGAT 0 3 69019 EU124737 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00022 TGAACTACTTCCATGTGAAGGTAGTTGGTCTGCTTTTTGTTGCGACATCTAGGACAAATT[T/G]GTCGCCTTCTCTAGTATTGGAGCTTCTCCAGAGGATTGCACGTGTAATCAAAGATTACCT 0 4 45599 CU468638 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00023 GAGATGCTCAAACACATCAGAGAATTTGAGGTAAAATCAGGTATTAAAGAGATTTATAGT[A/G]ATTGGGGGAAGAATAATTTAAATGGTGTTGTGAAGATGGAGATGAAGGAATGGATTGGAG 0 4 124617 CU914524 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00024 TCGGCGCTGAAGTCTAAGCTTCTCGACTAAAAAACTTAGTTCGGCTAACTTTATAGGTAT[C/G]TCTCAACAATCTCAAGTCCAGAATTTCGTGCATGTGTGCAACGCGCAAGTATGCATAGCA 0 9 100163 EF647604 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00025 TTCCCCCAAAACCCAAAACCCTCGCGTACCAGAGAATGAACAGAGAAGGAAGAGTTGAGA[A/T]TGAGGAAGATGAAGAACAAACCTTCGAAGAATTGGGACTTGACCCTCGTCTAATCCGTGC 0 2 42314 AC215482 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00026 GGAGGAGGCTGCTGTTATTGCCAGAATCAATAAGCGATCCCAAAATTGGAGAAGGATGAC[A/G]AGGCATCTCATTGTACTTTCTGTGATTTTTGAGGTAATGTACTGTTTTCTAGTGTATGTT 0 4 40785 CU012067 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00027 CCCACATTCCAGGTAACCTCATGATCCTTTGGACAAAACCCTTGTGTACTCATAAGTTAC[C/G]AATCGAGGATTTAAACTCTATGAGTTCAACTTTTAAGGTTTTTAACATTGAACATAGTAT 0 4 121565 CU041360 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00028 CATCAGATTCATGCGAGTGGATGCACTATCTCTACTGCTCTCCTTGGGGAATGTTACTGC[A/T]AATGCAGATGTACTTGTAGTGGACATGCTCAGTGGTATTCTTACTGGTGCTATTGCAGAA 0 4 25448 CU222538 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00029 TCTGACATATTCAAAAATTGAGTCCTTCTTTCTTCCCTATTTAACTTGTAATTATTGTTG[A/G]TTCCCTCAACAAAACTTAAAAAAGAAAAAATAAAATAAATCTGTTATTTTGTTATATAAA 0 2 39701 AC232772 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00030 GATCTTGAGGATATTGCGGGTAAAGGACCTTCAAGAAAGAAAGGAGTTAACGATAAGTTC[A/G]TTAATGGGAAGTCGAATGGTGGAACTGTGAATGGAGAGAAGGCAATGGTAACTCCAGTTA 0 4 134541 CU459062 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00031 CACTCGAACCTCTACGAAAAAACATCCCCCAGTTCACCAATGTGAGGTCATTGGGTGCTA[A/G]AAGAGTGCCTTTAACAGTAACAGCTTCTGCATCTACTGTTTCTGCTCCAAAAAGAGAGAA 0 2 62189 AC215389 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00032 AATGCTTCTATATCTTGTTCTTTTGATGTGCCTGTAGGTTAAGATACATAGGATGCTTTT[A/G]CAGTCAAGGTTCCGGACTAGAAAGAAAGAAGAGGCAGACCTTTTCTTTGTGCCTGCTTAT 0 4 56766 CU928193 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00033 TCTTTCTGGGCAGGCTCAAGCAATTTCCCTTGGCATTGCTCGTGCACTCCTAAAGGTTAG[T/C]GAGAGCCATAGAAAACCATTGAGGGAGGAGGGTCTGTTAACTAGAGATGCCAGAGTTGTT 0 4 42227 CU459025 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00034 GCTGATAATGTGATTGCATCTGCTGTTGAATCGGTGGTGGAGGAGAAAGGGGAAGAAAAT[T/C]TGTGTGTTGTTGATGAGAAAGATACAGCTTCAGATACTGTTGTGGAAAATTGGAAGGAAA 0 2 37371 AC215375 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00035 TTTTAACCTCATCATAACACCACCGCACAACTCACCAACCCCAAGAACCAAATACCTGCA[A/T]ACTCTCATTCTATCCTACTTCTTACCTATTTAGTTTTCTTGTTAATAATTATCTATATAT 0 4 112411 CU012067 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00036 ATTTTTGTCTTTCACGAACCGCAGCTTCTGCCATCAATATGGAGTGTTTTCACAGAAAAA[A/G]GATATGAGGCGAAGAAGGAAGCTCTTGTTCCAGCAATGCAAAACCTAGAATTCATTGAAG 0 1 32774 AC225023 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00037 ATATGTCTATTTGATTCTCGATAATCTTTCTCCTTTATCCGAATTTGAGACGGGCGATAC[A/G]AAGAAGCCAGTAATAGGGTTATTTTACGATTCTCAAGTATTTGGATAGTAACAACTATTC 0 2 43569 AC215463 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00038 CCGTCTATTCCTAGATTAATGTGTGGTTTTATTAATGTATCAGGTTGCTTCTCAAGCAGT[A/T]TATTCCTTACATAAGACCACAACTAGAGAAGTAAGTTCTTCCATACTATCCTGCCACAGC 0 12 98089 AC209585 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00039 GATATTATTCTTCCTATTATATATTTTGAATTTAATTTATATACGCTGACAGGTCGAAAG[A/G]GATTGACATCAGCAGAATCTGCAAAGCTTGGTGGTAGCTACAATATATTCCTACAAACTT 0 4 25773 CU468283 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00040 TGCTTACCCTGGACCAGCTGACACCCACGTTCCGCCATTCCTTGGTACTGCCTACAACTT[T/C]CCTCCCGGACATGGCAACTTCTTTGGAAATGGTTATCACTATCAGGCAACTTACCTGCAC 0 6 6948 AC226012 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00041 TGTTACTGGAAGCACTGATACATCACTCTGGACAGTCTACAATAAAGGGGTTCGCAATTA[T/C]TGCGGCAACAACCTTCCTGATGGTGTGGTTTGTATAATGCATGAATGCAACCGTTTTTGT 0 1 7128 AC225023 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00042 CACCTAATACTTCTTCATTTCTACTAATAATTAGTTTAGGCAAACCTGGGCGGATTGTGC[A/C]ATTTAGATTTGTCTTGAACGTCCTGGAATCATATGACCCTTTTGTCGGTGATGCGTACAA 0 2 70516 AC226515 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00043 GGTTCTTTTTGCTCTATTTTGCTTCTTTATAATATATTGGTTGGCCAAGTTTTCACGGAG[A/T]TAAGTGCAACTCACTTTCTATGTTGGTTTGCTGTTTCCTGGTACAAGTTCTGATGAAGAC 0 4 128312 CU928132 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00044 TTTGTTTTCGGGTGTGGGAGGAATAATAGAGGCTTGTTTGGTTTAGCTTCAGGTCTTATG[A/G]GACTTGGAAGGAGTGATCTTTCCTTAATATCTCAAACTTCTGATGTGTTTGGAGGTGTTT 0 3 50788 EU124731 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00045 TTGGTAGAAAATGTGTCAAAGCAACTACATGATTTGGTTAGGACTGATCCTAACGAAGCA[A/G]TTAATCTAAGGAAGTCATTTCAGTCGGAACTTTTTGGTTTAGCATTGAAACAAGTTAGTT 0 4 90406 CU914524 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00046 TTCATGGGTTTCGAACAAGTGGGAAAATTTTGAAGAAGCAAATATTTGATAAATGGCCAA[T/C]TGAAGTGGTGGATAAATTAGATCTAGTTTTTGTTGATGCGCCTTTTCCATCTCAAGGCAA 0 4 142525 CU928132 0 diploid Lycopersicon esculentum Forward
SC_S_Sl_00047 CAACCAGGGTTTTGAGTTACCATTGAAGTGCAGCACAGCTCCCTTTTCTATCAATTTGGA[A/G]TCGACATTCGTGTAACCAAAACCTAAGACATGCCATGAAGGATTCAAAGCCTCTGTCAAT 0 4 53010 CU914527 0 diploid Lycopersicon esculentum Reverse
SC_S_Sl_00048 AGTTATAATATTTTTGACATTTTTTCATTAATTTTGGTGAGGAAGGCTTTTGGGAAAATC[A/T]GTAATGCAATCTGTACAACTCTATGTGTTTGGCCCCAAGAATTCAGAGCAATTTACAAGA 0 4 28522 CU459025 0 diploid Lycopersicon esculentum Reverse