Potato SNP Position and Context Sequence

The following table contains context sequence and mapping information relative to the DM version 3 superscaffolds available through the potato genome sequencing consortium for the 8,303 SNPs included in the SolCAP Infinium SNP platform. These SNPs are part of a larger set of 69,011 SNPs identified from Atlantic, Premier Russet, and Snowden RNAseq. SNPs were aligned to the genomic sequence using 50bp of context sequence on both sides of the SNP and required 95% sequence identity, 95% of the length, no insertions/deletions, and 2 or less alignments. Mapping information and context sequence for both the 8,303 and 69,011 SNP sets are available for download.

8,303 SNP mapping information and context sequence
69,011 SNP mapping information and context sequence


SolCAP 8,303 Infinium SNP Mapping Information and Sequence
Columns can be sorted by clicking on the column header.

Name Superscaffold Position Sequence
solcap_snp_c1_1 PGSC0003DMB000000011 994825 GTATTCCGTTTATCTTAAGTTGACAACCGCAAAGA CACAATAGAACTTTT[A/G]CTTCACCACATACCT CACAAGCACAATTTCACTACATAGCCCATATGTTC
solcap_snp_c1_7 PGSC0003DMB000000011 2736486 ATGATTCATCACTACACACTCAGTTGTGGATAGAT CCCACTGAAGAGTTT[G/A]TGCAGTATAATCATA ATGCAAACCCTGTGGATGTGACATTTGGAGTGAAG
solcap_snp_c1_8 PGSC0003DMB000000012 1510771 CTCACTTGTGTTGCTTACCCAAAGTGTGATGTTAC CATTGAGACTCACAA[G/A]GAGGAGGAGCTTACT GCTTAAACTTCAACCATTTCCATTTAAATAAAAAC
solcap_snp_c1_9 PGSC0003DMB000000012 1510925 CATTCTTGACCAAGCTGAGGAAGAAGGACATGATC TTCCTTACTCATGCA[G/A]GGCTGGTTCTTGCTC ATCTTGTGCTGGAAAAGTTACTGCTGGAACTGTTG
solcap_snp_c1_11 PGSC0003DMB000000012 1624775 GGGTAGTCCAAGTATACATCAAAACGATGAGCAAA ACTGATATTGGTAGG[T/C]TCCCATTTGACAGAA TATGTCATGTCCAAGGTTCTCCCAGCTTCCAAAGG
solcap_snp_c1_16 PGSC0003DMB000000012 3530746 TTACTAGTCCTCAAGTTAATGGGACACGAGTTGGC AAATCTACCTCGATC[A/G]GAAGTGCAGCTGGTC CATATAATTATTCTAAAAATTACAATCCAATTAGC
solcap_snp_c1_22 PGSC0003DMB000000073 1877893 AGAAAATCAAAATCCCTTTCAATAACAGAGTAGGA AGGTGCTACGCATAA[T/C]ATAGCTTAAGATCAT TACAATATTTGGACAATAGATCACTTAAACTGGAT
solcap_snp_c1_23 PGSC0003DMB000000073 1878022 GATGAACTTTTTCTTTAATAACTGTGATGTCCAGG TCAATTTGCAATTCC[A/C]CAGCGCAGCTGCCGA GTAACTATGCCCACCCAGACTCGGGTAGACAAGAA
solcap_snp_c1_26 PGSC0003DMB000000026 1926129 TACAGAAATGAGCCCTTGCTACTGGTGGCTGCAAA ATTCCCTGCATTGGC[G/A]CATTCTGCCGGAACA GTACCAGTATGTACCTGTGTATCCCAACTGGTGGA
solcap_snp_c1_36 PGSC0003DMB000000026 1877559 ACATCAAAACTCTCAAACTCATGAGAAACAAGGAG AATCCAGATACTTGT[C/T]GTCAAACATTTTTAA GAGAAATCTAAACGTCTTTAATGGACTATTGCCCA
solcap_snp_c1_38 PGSC0003DMB000000026 1877428 ACCATGTATTAGGTCAAAGAATTGAAAACATAACA GGACGAGCCGGGGAG[G/T]AATAACATACATGGC GAACCAAATTGAAGTGTAGCAACATAAGCTTGTAA
solcap_snp_c1_58 PGSC0003DMB000000026 1722969 TGCCTTTCCAATTCTGTGCGGATAAGAGATAAATT ACTCAAAAAGAAGGG[C/T]TTGGTTCTTCTAACA CATCGAGCTATCTCGTCTTCTCTCAATCCTGTGTT
solcap_snp_c1_97 PGSC0003DMB000000026 837026 TGTGCAACGCTTGTTACTAATCCTTTGTGTGTCAA CATCACCCCTTTCGG[C/A]AGCCCGGTAGTCCCG GAGGAATACGGCAGCGCTACGACATCGTCCGGCTG
solcap_snp_c1_99 PGSC0003DMB000000026 835243 ATCAATTCCTTCAATCGGTCCACAATGAAAAGCTC ATCATCATCGTCAAT[G/A]AATCCAATATCGCCA GTGTGTAACCATCCTTCTTTTTCTATTGTTCTAGC
solcap_snp_c1_108 PGSC0003DMB000000026 674958 CGAGCCATGTCTGACCATGTGTTGATGAAGTGAAG ACCAGAAGCTCCATC[T/A]GCTGCATGATGTTGC ATGCCCACACCAAGGGAAACTCCCCCACATTTAAA
solcap_snp_c1_110 PGSC0003DMB000000026 563721 TTCCCAACACCTTTTCTCGCTTCCAAAGTTGTTCT TGCATTTGCATATGT[T/C]GCAATTTTCATCCCT AAGAAACCAGAGATAACAGAAGTGACAGCACCAAG
solcap_snp_c1_111 PGSC0003DMB000000026 563451 GGATCATCTTCTGGAATGTTCCTTTCAACCTTACC AACGAGATCAGCACC[A/G]ACATCAGCAGCTTTG GTGTAAATACCACCACCAACCCTACCGAAAAGAGC
solcap_snp_c1_112 PGSC0003DMB000000026 562321 ATTGCAGTTGCTGCTCTTGGAATGTTGAGCACAAT TGCAACTGGATTGGC[G/A]ATTGATGCATATGGT CCTATCAGTGACAATGCTGGAGGCATTGCTGAGAT
solcap_snp_c1_129 PGSC0003DMB000000026 2499636 GACGCAGGACTGGTTTACCAATATGGTGGAGATGG GGACGAAAGAGGCTG[T/G]TGTATCGCATACTGT CCAAGCAGCTGCGTGCAAAGTCCTCTTGTAATTTT
solcap_snp_c1_151 PGSC0003DMB000000026 2212249 AAAAGTAAAGCGCGAAATTTGAGAAGAACGATGTT TCCATCCTGGATTAG[T/C]TCTTCAGCTTGAGAT ATTACATTTTGAACAGCCAAAAGTTGCTCCATGGC
solcap_snp_c1_156 PGSC0003DMB000000435 90041 AATGGATTATTCCATCTCATTGATTCATCACTAGA CCATTTCATGACTAC[G/A]TCTTCAACAACCAGA CCATCAATATGCTCCATCATGAATCCCGCAGGTTG
solcap_snp_c1_167 PGSC0003DMB000000435 459662 AGACCATCCACTATCGCCCTGCGAAATGCACCATT ATGGAGAAGGAAGGA[T/C]GATACATGCCCTCCT CTAACCCATCTAACTTCTGAGCCAGGCCAAGCTTT
solcap_snp_c1_171 PGSC0003DMB000000036 1790129 TTGTCTTGGATAGAAATGACCATTTTAACTCTGTC AGTTGAGGGTTTTGA[C/T]GGCATCTCAGCAACA CTATCTTGAAGTGAATGGAGCGAAGCACTAAGATC
solcap_snp_c1_197 PGSC0003DMB000000351 310289 TGGGATTTGAAACTGCAACAAACCATGGTAGAAAT GTTTCCATTGAGGTC[A/C]GAAGATGCTGCCTAT AGCAAAGTAAGGGGAATGCTATCTACGCTTGGAGA
solcap_snp_c1_200 PGSC0003DMB000000351 291380 GCACTAGCTGCCTTAGCTGGTGACGGGCACAAGAA CGACTGGGAAAATCC[G/A]ACTCAAGAAAGAGCT GAAGCTCTGGAATCCCTTTTAGAGGTTTGTGCACG
solcap_snp_c1_211 PGSC0003DMB000000053 949963 GAGAAAAAGATAACAGCAAAGCACATTGTGTTCTG GGTTGAGAAGCGCTT[A/G]GCTGCCCAAGGAATT ATTCCTGTCTGGAAAGAATAAGTGTGTATATTGTC
solcap_snp_c1_212 PGSC0003DMB000000053 1433022 CCATGGCGCAGCAAGTTCACCGCCATTGCTTTTCC CATAATACCAATCCC[C/T]AGAAACCCTATTTCC TCCATTCTTTTTTTCTCTTTCTTCTTTCTACACTG
solcap_snp_c1_216 PGSC0003DMB000000053 2244824 CTGACCATATGCGGAGGAAAGAGAAGAGTCTTTGT ATGCGGAGGATGCTC[T/G]TATGGCCTTAGCAGC CAGAGAAGAAGCAGATGATGAAGAAGAACTCTCAT
solcap_snp_c1_225 PGSC0003DMB000000299 238295 CGTCCATGGACAAGCAGTAAATCAGCGAGAAATCG GAACTGAGCTATTGC[G/A]AAATCACTAGCCATC ACTGCTTGCATTCCCTCCTGTCCACTTATTCCAAC
solcap_snp_c1_233 PGSC0003DMB000000287 170053 TCCAACACATTGCTATTTGGCATAGTGATCTGTTT GACATGTGCTTTTGT[C/T]ATTTTTTGTTCTCAC CTTGTTTCTCAAGCGTATTGAAGCTGTTGCAGCTT
solcap_snp_c1_237 PGSC0003DMB000000359 431050 GTCATTGAGAATGAATGGTTCAAGAAAGGGTATTG TCCACCTGTTTTTGA[A/G]CAGGCAGATGTTAGT CTTGATGACGTGAATGCTATTTTTGATGAATCTGC
solcap_snp_c1_239 PGSC0003DMB000000359 214596 TTACTCCAGATTCAGCAAAATTGGCACCCAGATCA GCAGCTATTGCAGCA[C/T]TAACAGCAAGTTTCA ATAAACCTTTACCTGCCAAGGAAGTCATAATACCT
solcap_snp_c1_242 PGSC0003DMB000000320 362192 TGCACTCGAGCTTCATTAGGCTCGATAGTACAAAA AGGAAAGTTTTCTGC[C/T]GGAATGGATAACTTT GTCAGTGTGTTGAAGAGAGTAGACTTCCCCACATT
solcap_snp_c1_274 PGSC0003DMB000000421 473018 ACGCCATATTGGCATATCTCAAAGACAACGATGAG ATTTCAAATTCTGCT[G/A]ACTTTGCCCAGGATT TGGGTTTTAGCCATGACGACATCGTCAATGTCATT
solcap_snp_c1_287 PGSC0003DMB000000312 458750 CGAGTGGATAGGGTTGTGGGAGAGTGAGAAAATGA CGACTCGGAATTTGG[A/T]GAAATTGGCATCCAT TGATGCCCAACTGAGGGCTTTGGTTCCTGGTAAGG
solcap_snp_c1_288 PGSC0003DMB000000312 441266 AATTGGTAGACTTAGGGCAGCCTATGAAGAAAATG GTGGTTTGCAAGAAA[C/G]TAACCCTTTTGCAAG TGGTGCTATACGTGTCTATTTAAGAGAAGTGAGAG
solcap_snp_c1_289 PGSC0003DMB000000312 347991 GCTATATTCTACATTGTGTTCATGCTATCAGCATG TGCCTTATTCTCAAA[G/A]ACTTGGATAGAAGTC TCAGGATCATCAGCAAGAGATGTGGCTAAGCAGTT
solcap_snp_c1_305 PGSC0003DMB000000149 1098620 TGAATACCCATTTTCTCCATCTCCTCAAAAGTCCT CTTAGCCTCATCAAG[T/C]AGTCCGGCCTGACCG TAAAGAACAATGAAATGGGAAATGAACCGCTCCGA
solcap_snp_c1_307 PGSC0003DMB000000149 1097933 TTTGAAATGCTAGCCAATCCTTCAACAAGAGACTT CATGGTGGAAAAATT[C/T]GGAACCCATCCATCA GCCAAACATTTTTTATACATCTCCAATGCAGCTTC
solcap_snp_c1_329 PGSC0003DMB000000149 872485 CTTATTATTCCAACAGAAACAAGTGCAGCTTTCCC CTTCAAAATAAAATC[C/A]TGTATAGCATCAGGT ATATCAGCAGAACAACCTGGTGGTACAAGTGGAAA
solcap_snp_c1_335 PGSC0003DMB000000149 731114 TTGAGCTCTAGTGCTGTCTTAAAAGACTCTATAGC TTTGTCATATTCTCT[T/G]GATAGATTGTATAAC ACCCCAAGTACAATGTGTACGTCAGCATCCTCAGG
solcap_snp_c1_357 PGSC0003DMB000000149 380981 TCAGATTGCAAGGTATACATGATACCGTCTATTGT AGTTGATGTGTTTGT[G/T]CACCCCCGTGATAAG ACCAGTACCTCTGGTACTATGTTGAGCGTTAGAGT
solcap_snp_c1_364 PGSC0003DMB000000380 98164 GAGGGAGCCGCAGATGACGCTTGGGATGACTGATG TTTGTTGTCCACATC[T/C]TATGTGCCTCTACTC CGATAGTTGTAGTAGCAGTGGCAATGCCGTGATGC
solcap_snp_c1_369 PGSC0003DMB000000333 306760 AAGGCGCGTTCTTTCTAAAGTAATGGGGCAATCAT TACTCGACAACTTGA[C/T]GCTGACAGGTGCAAC TGCTAAATCAAACACTCCACTTTTGCTAAACCAAC
solcap_snp_c1_378 PGSC0003DMB000000127 972854 CCAAAAACAGTAACAGCCTTCTCACCAAAGAGAAG GGTTTTCTCATCCTT[A/G]ACCTTAAGCTCATGA TGCTTCCACTGGCCGTGTACACTATCATACTTAAA
solcap_snp_c1_398 PGSC0003DMB000000127 57995 TAATAAGTATCAAATTATCATTTCTATTCATAGCG CATATTATCCATACG[G/T]TATATCTTACACTGA CGCAAGCAGGTGACGAACAATACAAATGGTGAGAG
solcap_snp_c1_403 PGSC0003DMB000000038 262438 CATATTGTCTGTCCTCTTCATTCAGAAGGTTCTAT CTAATCTAGTGCATA[G/T]GCATTGCTAAATTTG CTGTGTAAAATAAAATATACCAAGCCATCTCTAGT
solcap_snp_c1_432 PGSC0003DMB000000127 621429 GCAGTTTCCATAAAGCACACTTCTTTAATCAACTC CGAGTCTCCAAAAAC[C/T]TGGTCACATAAGCTC TTTTCAGCAGATAGAAGAATTCTCACCAGAACTTT
solcap_snp_c1_433 PGSC0003DMB000000127 621534 GCATAAATCCATTTTTTCATTTTCTCATCCAGCGA CTGCCAATCAATCCT[A/G]TGGACCTCCTCAATG CTCAGTTTCTCAATGCCAAGAATTGCTAAACACTC
solcap_snp_c1_449 PGSC0003DMB000000023 1731274 GAAGAGTAAACCCCAGATGACATAACATCGGGCGA CGTCATACGGCTACC[A/G]GAGGCTTCAAATGTT GCCGGAGTGAGATGATCATGATCATGATCATTGGG
solcap_snp_c1_450 PGSC0003DMB000000108 311102 TTAATGAACCTCAGTTTGTAGCCTTGATCACAAGA ATTACGAAGATGATG[C/T]TTGTATTATATAGTA ACTTGCTTGTCTATTTTAGACCTGTAATTTTTGGC
solcap_snp_c1_456 PGSC0003DMB000000108 1151967 CATAACCATTCAACAACAGCATATTGGGGTGATAA TTGGGATCCAATTTC[C/T]TCAGATAGAAGAGGA AACCACACCTGTTTTGACCCTGACAAAGATCTCGT
solcap_snp_c1_459 PGSC0003DMB000000108 1404965 AGCAATCTCTGGCACATTTTCCTTACATCCAATGG AAGATCTGAAGAGCA[T/C]ATATCTTGAAGCAAT GTTCTGGCCTCCACAAGCCCACCAGAAATTTTCTG
solcap_snp_c1_465 PGSC0003DMB000000041 1891520 TTACGCCAGGGCCGTGCCAAGGAGTTCTTTACTGC TGGTCTATGGGATTC[A/G]GGTCCACATGATGAT TTGGTTGAGGTCCTACACTTGGCTGTGGTCTGCAC
solcap_snp_c1_476 PGSC0003DMB000000041 2106360 TTCCTGCATACTGTACATGTTAGTGTTACCTGTAA GTATTTACATTCACA[A/G]GTGCTGCCTTAACCT GCTACTGCTTCTTCTGCCACTATTACTACTCTTCA
solcap_snp_c1_482 PGSC0003DMB000000037 205096 ATTATTAACCCGGATTGTTGATTCGAAAAGTCAAA AACAGATTGATTTGC[A/G]AATTGCTCCTGAGAT GACCAATCCAATTTAAGCTCCGTTTTGTCTTCTTC
solcap_snp_c1_483 PGSC0003DMB000000037 205097 CATTATTAACCCGGATTGTTGATTCGAAAAGTCAA AAACAGATTGATTTG[C/T]AAATTGCTCCTGAGA TGACCAATCCAATTTAAGCTCCGTTTTGTCTTCTT
solcap_snp_c1_500 PGSC0003DMB000000037 525357 GATTGCCTAAAACAATGGTTGTAAAACTTATAGGG CGTCTGAATTGAAAG[A/G]ATTTTCAGGAACTTT TGGTTGCCAATCGTACATATTTGCCATCAACAACG
solcap_snp_c1_512 PGSC0003DMB000000079 1916208 CTACTAGCATAGTAACCATTTTCCAGCATATCTTT TACATGCAAATATAA[A/C]TGCTCCATTCCAACT ATTACACATACTGTTTAACTTATATAATGGCAGCC
solcap_snp_c1_513 PGSC0003DMB000000252 81126 AAGCGCTCTGCAATGCCTTTCTCTAGATTATAACG GCCAGACAAATTGAT[G/T]ACTGTGTGAACATTA TGATACTTAGAAGCATATAGAAGCACAACATCCCC
solcap_snp_c1_516 PGSC0003DMB000000045 421429 TAATTCAGCTATTATATACATGGAGTGGGCAAAAT CCTTTATAGGATATG[T/C]ACACTACTATTGGAC TAGAGAGTGTAAATCTTGGAGAACTTCAGTTTCTT
solcap_snp_c1_526 PGSC0003DMB000000093 322596 ATGTCCTCAAACGACTCTGTTAGTACGGTTTATAG ATGCATGCTGAGAGG[T/G]GCAGCAGACTTTCTT GTCAAGCCAGTTAGGAAGAATGAATTAAAGAACCT
solcap_snp_c1_573 PGSC0003DMB000000363 170401 ATGATCAATTGGACCTGGTAGCTGGAATGAAACAG AAAATTCTCCCGGTG[G/A]ACATAGGTTTTGAGT TTGCATCTTAAAAACCATGTTGTCCCTGCGAACCA
solcap_snp_c1_590 PGSC0003DMB000000060 1285848 GCTGCATTGGACAAGGATTCTGCAATGGCTTCAAC AAAGGATCAGCAACA[C/T]CAGCAGCCAAACCAG TACTGTCAATAACATCATTTAAATACCTGAGCCTA
solcap_snp_c1_594 PGSC0003DMB000000363 154989 AACTCAGATCCCCGCCATCAACTTGTTTTATAGTT CAGGTCTTTGATTAA[A/G]AACTTGCAATAATTA TAGAGACAAATTTCATTTAGTTTTCTTTTTATTTC
solcap_snp_c1_601 PGSC0003DMB000000060 1311976 AAAACTGGTTTCACCATTGCTATCCCTGTGGTCTC TTCCTCTGATTCAGT[T/C]TCATATTCTGATTCC TCTTCCTCCTCTTCTTCTACCTCCTCTTCTTCTTC
solcap_snp_c1_607 PGSC0003DMB000000060 1320032 ACTTGTTGAAGTAATTAAATTATCTTTGCATAGGG AACTGAGCTGTGACT[T/C]TATGTTATTCAAGAA ACTTGTAGCTTCATCAAACGGCTTTGAAAGCTCCT
solcap_snp_c1_636 PGSC0003DMB000000363 130364 ATCTTCCTGTTGCAACTTGCTCTTGCCTTGGTACT GAGGGTTTACTTATT[C/T]AACGTTACAGTATAG CTATGAAACTATTGAAATGTATCTAGGATCGGTTT
solcap_snp_c1_641 PGSC0003DMB000000363 124436 AGTAAAGAAATCCCTAGGCCATCAAATGCTTCACT CCAACTACCTTCTGT[C/A]AGTGTTTTCCAAAGG CTTTTTGATTTCCCAAATGCACTTGTCTGCATCCT
solcap_snp_c1_683 PGSC0003DMB000000363 19844 CACGGTCTATCTTGAAATGACTTTCATGAAGCGGT TTATAGAAGAGAAGA[T/C]TCCAGCTGCTTGATT TAACAGTGAGGGGCCCTTATCTTCCTTCTCATCCA
solcap_snp_c1_691 PGSC0003DMB000000060 103431 GTTCATCGTTTCACGAAAATGAGGAAGGAGAAGCT TATGAATAGGGTGAA[C/G]CACACTTAGTTGCCT ATTTGTTGCAATCACAAATGGCTCGATCACTGTGT
solcap_snp_c1_711 PGSC0003DMB000000060 351407 ACAGTCACTACCATGTCCACCTGCGAAATTATAAA TAGATACAATAAAAA[C/T]AAAAGCCACACAAGA AGTAGGGTAGCATGCACCCAGCTAGCTTCCCAAGT
solcap_snp_c1_728 PGSC0003DMB000000060 494966 AATCAGCCAATGAAGATATACTCAAGTCTTTGGGA CGCAGATGATTGGGC[C/T]ACAAGAGGTGGGCTT GAGAAAACCGATTGGTCCAATGCCCCATTTACCGC
solcap_snp_c1_730 PGSC0003DMB000000060 497083 AGAGAAACAAAAAACTGATCTCTGATTGGCTTGGT TTTTCTCATCATGGG[T/A]ACCATAAAAGGAGTT TTATTTAGTATTGTTTTGATTAATTTGTCACTTGT
solcap_snp_c1_737 PGSC0003DMB000000060 545163 TGAAATTTATCATAAACAGGGCCAACCACAGTCTT GACGGTGCCTTCAAC[A/G]GTCTGAACACCAGGC TTCAAGGGACCAGAATTCTCTTTAGCGTAACCATA
solcap_snp_c1_758 PGSC0003DMB000000060 670674 CATAGTATTTATCAAACAGCTGCCGCAATCTCTAA TACCAATCACCCGAC[G/A]GGAACACATTGAAAC AAGAACCATTTGCAACACACTTTCTGGAGGTTGCA
solcap_snp_c1_805 PGSC0003DMB000000035 951633 AAAGCAAAAGGCGTAATTGATTTTGTCAATCGCTG TTTGGCATTTGAGTC[G/A]ATTGAGGTGGGGCAT TATCTGAAAGCAGTAAGAGATCTGGATTCGATCCT
solcap_snp_c1_812 PGSC0003DMB000000643 21292 TTAGGACTAACACCCAAATGATCAAGAAGTATCTT TACTCCACTGCCCTT[A/G]GAAGTTCCAGGAGGA ACAATTTCAAGTATGTCTGGTTGAGCTTGGACAAC
solcap_snp_c1_816 PGSC0003DMB000000198 65687 TTGCAAGTCGGACAGGAGCTAATGAAGGAAACTCT TCCATTACAATCCGG[G/A]TCGAGACTATATGAA CTGCAAGGGTTGAATTCCAATAAGTGGTATGAAGT
solcap_snp_c1_819 PGSC0003DMB000000198 124360 AAAGGCATTAATTTCATCTATACATCAGACTGACC GTAAATCTTGTGCTG[C/G]TAGCAACTCAAGCGA GCATCATCTGGAGAAAATGTTCTCTCTGTTCATGG
solcap_snp_c1_821 PGSC0003DMB000000198 125704 AATCCATTAGCTGGTGAATTTGGACCTTGGACTTC ACTGGAGAGTCTTGA[G/A]TGCAAAGGCGTTATT AAAGCCATGCTAATTACAAGTGATCGACACCAAGC
solcap_snp_c1_822 PGSC0003DMB000000198 126746 CCTGAAGGAGAGAGCACGACTTCTCCAAATGCTGC AACTGCTGATAAGAG[A/G]CAGAAGGTTTTATTG GTTGCTCCGCATTTAAACCATGACAATCCTGTTGT
solcap_snp_c1_823 PGSC0003DMB000000198 150287 GTAATGTTCCACAAAGCATATACACGTGCAAGACC AGCAGAACGCCTTTG[C/T]CCATGACTGAAGAGA GCATTAATTCCAGCAGGAAATGGAAGTAACATCCC
solcap_snp_c1_836 PGSC0003DMB000000198 240969 GATTCCGCCAGCCCACGCGGAGTCATCGGAGGAGA TTCAAGCGGCGGAGA[C/T]GACGAAAACGATTCA AACCCGACCCGACCCGGAGACCCATCAAACGAATC
solcap_snp_c1_838 PGSC0003DMB000000198 360690 ACCTCTTGTATCTTCTCTTTGTTATTTAATAATGC CACAACATTTTCCGC[C/T]TTCTTCCTCACATTA ATTCCCACATCCTTACCGTTTGGCTCAACATACTC
solcap_snp_c1_859 PGSC0003DMB000000460 273456 ATTAGGGAGCATGCACCCATCCACTAGTGCTAGTC ATGCTGCTGATTCTG[C/T]GGAAGTTTATGGTTC AGCTCTCCCCGATATCTTCAATGCTAGCATTTCTA
solcap_snp_c1_868 PGSC0003DMB000000122 1313998 GTGCCTACACCAATCTCCCCAAAGTATTGAGCATC CATATAGTTCTTCAG[T/C]GCTACAATGTCTGTA TCCTCAGAGTCCCCAAGTTTACCACGGAAGTTATA
solcap_snp_c1_880 PGSC0003DMB000000347 376303 CGGGTTCTAGAGATTCAAGCAAAGAATGCTGCTCT TGGGAAGAAAGTAAA[A/G]GACCCCGCAGCTACA AAAGCAGCTAAGGGTAGGGAGGCATCGTATTATAG
solcap_snp_c1_890 PGSC0003DMB000000122 1367108 GATGAGAAGATGAAGAGAGAGAGCCATGAATTGCA GTTGAAGAAGTGAAA[G/A]CCAAAGCCATTTCTC AAACAGATTGATTTTTCCAACTGAAAAGAGCAAAA
solcap_snp_c1_898 PGSC0003DMB000000462 251404 GCTGGTGTTGTGAGGCGACAGGCTGTTGATATTTC TCCACTCCGTCGTGT[T/C]AACCAGGCAATATAT CTCCTCACAACTGGTGCACGTGAGAGTTCTTTCAG
solcap_snp_c1_914 PGSC0003DMB000000319 223129 AAATTTGAAAATCTCAGAGAGAAAACAATGGCGTC GAAATCGAGCATGAA[A/G]GGTTTCTACAAGCAG CAGAAGAAGAGTGGTGGCATCACAAAACCATCGAA
solcap_snp_c1_925 PGSC0003DMB000000596 74411 TTACGACTCAACGTTATCCAGTTAGTCCTCGTACC CTTCACCATAACCTT[C/T]GTAATGTCACCTGCA CCAGCGACATTCGTGACTAAAACCAAGTTGAAGTA
solcap_snp_c1_946 PGSC0003DMB000000124 205762 TATTTGGTAACTGCTTCTGTTGATAAAATGGTGCT GAAGAAGCCGATCAG[C/T]GTTGACACTGATCTG AAAATGGTTGGTGCAGTCATTTGGGTTGGTTTTTC
solcap_snp_c1_958 PGSC0003DMB000000161 1310595 GTAGAATTGGAAAGATTCAAGAATAGATGGAAAAA AGCTGCCAGAGAAGA[T/C]CAATGTTGGGTTGAT CCCTTTCAGCGGCCTGTGAAACAAAAAAAGTGACT
solcap_snp_c1_964 PGSC0003DMB000000004 345433 GGCCATGTTTGAAGAAGAAATCACCACAGTTGTTA TTTGCCCCAAATTCA[G/A]ACGCATAATTGGGCC ATGAAAATCGGCGAGTTTGGCAAGGGATTTATGAG
solcap_snp_c1_973 PGSC0003DMB000000409 329993 CTCATATCTATAGTAAGGGTTTCTACTCTGGTATA TATGTTGACGTTCAT[A/G]ATTCCTTGGACCAAT CACTTCTTTGTCAATCATTCTCCACCGTTCATAAA
solcap_snp_c1_975 PGSC0003DMB000000409 322739 TCCAGGGAAGGACGGACCACAACTTTTACTGTTGT GTCAAGGCTCTCCTG[A/G]CATCTTATGTGAATT GGGACAATCCAAAAAGGAAATGCAGGATCCAACAA
solcap_snp_c1_977 PGSC0003DMB000000409 315317 TTTGATTTCATAAAATTTCTAGTTAGTTAATTGTA GGGGTTTTTCCAGTT[C/T]TCTGTACGGTGAAGC GTGAAGTTTTCTTCTGGTTTTCAAGCTGAGTTCTT
solcap_snp_c1_988 PGSC0003DMB000000409 244935 AGATCCATAACTCTCGATACACCGGTACTCTTGAT TTCAGCCTTCAATGC[A/G]TCCATCTTCTCCTTC AAATCTGGGCGGTTCATGACTTCTTTTAACCTCTT
solcap_snp_c1_992 PGSC0003DMB000000409 245154 AGAAGAATTGATGAATTTAACAATGAAATTACAAC GGTTATGGAAGACCT[C/T]GTGAACTCCACAGAT TTGAAAAACAAGATTGAATTGTTAAAGATGGAGGT
solcap_snp_c1_1000 PGSC0003DMB000000409 207255 AGGGTTTTTTTACTCTGTTTTCTCATCCTTTCGTC GAATTTCTCTCATTT[G/A]CAATCGGAGGAAACG AAGACTAACAAATTCCGAGAACGAGAAGCTACAGA
solcap_snp_c1_1019 PGSC0003DMB000000409 49190 CAATCAAATTGACAACAAAATATCATAATACATTT TCAGGTCAATATTCT[A/G]CAAACACATCTTGAT GCAAATCTATGAAGGATACACCTTACAAAAAGCAT
solcap_snp_c1_1020 PGSC0003DMB000000409 49085 AACAAGCTCTATGCTTTCAGAGGAAAGGATCTATT ACCTATACTCGACTT[T/C]TGGAGCTGCGAATAT ACGCTGAAACAACCATTGAAATGGTCTCAGGAATT
solcap_snp_c1_1023 PGSC0003DMB000000409 48844 AAAAGAGGCACTAGTTTGCTCATGCAGTCGTCTAG GTCCCCAGGAGTAAA[C/T]AGGTATCCAATCTTG CCCTGCTGATCATCAGGGATGATGTCTGGAACTCC
solcap_snp_c1_1029 PGSC0003DMB000000627 213976 AAGCAAGCAGAGGAAGCAATTGTCCCAAATTTCAG TGATACTGATGGAAA[T/C]TGCAGCAAAGAAGAA GTTGAAAAATTAGAAGACGATCAATCGCTTTTTAA
solcap_snp_c1_1051 PGSC0003DMB000000627 161493 GAATTCAAAAAAGGTCTAGGCAATCCTGAAGACTT GGGTAATTGGGATCC[G/C]AAAACTGATTGTTGT ACTGATTGGTACGGACCTACTATCAGATGCGATGA
solcap_snp_c1_1052 PGSC0003DMB000000627 161472 AATGACAAAAAAGCCCTCCTAGAATTCAAAAAAGG TCTAGGCAATCCTGA[A/T]GACTTGGGTAATTGG GATCCGAAAACTGATTGTTGTACTGATTGGTACGG
solcap_snp_c1_1053 PGSC0003DMB000000627 137894 TTGGTTTGGTTCGTGGAAGGGTTACCCATGTTGTG TGGCCTCCTCACCGG[G/A]TTGGTAAAGTTGAAA GAATGACACCAAAGAGCCTAACACCTTTCTAATTG
solcap_snp_c1_1059 PGSC0003DMB000000627 27567 CGAAACTTGCAAGTTTGTCTTGAAATGAGACAGAG TTATGTATTCAAGGA[G/A]GCTGTTGCTCCTTGG GTGAAGGAAGTAATCTCTGATCCATGCACCCCAAA
solcap_snp_c1_1074 PGSC0003DMB000000072 239370 ATTAGAGAGTATATGGCAAAGCACACAGCAAGGAA GAACAACACATAGGA[C/T]AAATATTTCATGGCA AGATCATCATATTCTTTCGTCTTATTTCCAGCATA
solcap_snp_c1_1077 PGSC0003DMB000000072 240109 AATTTTGGAATAAAAACAAGTCCATGGAAGGGCTA TCTGCAAAATCAGTG[A/G]TTGTGAACTTTTTCT GCCAGTTTATTGTCTTCCTGTATTTGCTTGATAAT
solcap_snp_c1_1093 PGSC0003DMB000000072 298708 GTGGAAGAGATGAATCAGCTGACTTTGCTGCAGCT GGAGAAGGTGCAGGG[G/A]TTTGAATTGGAGCAG GTGCAGGTGCAGGTGGAGGAGGTGCATTAGATTGT
solcap_snp_c1_1094 PGSC0003DMB000000072 298760 TTGAATTGGAGCAGGTGCAGGTGCAGGTGGAGGAG GTGCATTAGATTGTA[C/T]AGATGGTACATGATA TGATTGTATAAATGGAGCTTGTGCAGGAGCAGGAG
solcap_snp_c1_1107 PGSC0003DMB000000072 344692 TACACATTCATTCTTAGACCTGATGCATCATACAG CATCTGGATTGATGG[T/C]CGAGAAAGGGATTCT GGAAGCATGTATACAGACTGGGATATCTTTCCTCC
solcap_snp_c1_1116 PGSC0003DMB000000072 359917 ATCAAAAGGAAGGGATGATGGCAGGAGCGATAGAA ACAGAGTTAGGGATG[G/A]GTCCAAAGATGGGTG GAAAAGAAGGCAAGGGAACTTTGTTGACAAGGAAA
solcap_snp_c1_1123 PGSC0003DMB000000072 371983 CTTGTTTTGCCTAAGGAGATTGAGAGTATTAGATG TGATTTGGAGAATGG[A/G]AAGGCACCAATTGGT AATAGAATTCAAGAATGCAGGTCATATCCATTGTA
solcap_snp_c1_1124 PGSC0003DMB000000072 372006 GTGCATTTGAGGAAGAATTGAAACTTGTTTTGCCT AAGGAGATTGAGAGT[A/G]TTAGATGTGATTTGG AGAATGGAAAGGCACCAATTGGTAATAGAATTCAA
solcap_snp_c1_1125 PGSC0003DMB000000072 372009 TTAGTGCATTTGAGGAAGAATTGAAACTTGTTTTG CCTAAGGAGATTGAG[A/G]GTATTAGATGTGATT TGGAGAATGGAAAGGCACCAATTGGTAATAGAATT
solcap_snp_c1_1126 PGSC0003DMB000000072 372844 CGAATCACCTCGATTTGTGGGCCTAACCATTGTGG AGATGTCCTAAGCGC[G/A]TAACGATCTTGTTTA GGCTTTTGTAACGGGTCCATTTCATGGATTTTCTT
solcap_snp_c1_1127 PGSC0003DMB000000072 372871 CATTGTGGAGATGTCCTAAGCGCGTAACGATCTTG TTTAGGCTTTTGTAA[C/T]GGGTCCATTTCATGG ATTTTCTTGGCTTCTTTCACATAGGAACTTCCATC
solcap_snp_c1_1163 PGSC0003DMB000000072 481960 ATAAGACCACCTACTTTATTCAATGTGACCCAACT GAGACAATTCTACAA[A/C]TGAAGGAGAAATTGT CTAACCTCATAGATCAACCTGCTAATGATCAGCAA
solcap_snp_c1_1195 PGSC0003DMB000000072 635049 ATTTCTTCGCGATTGCTGATGGCCAGACAAAGAAA GTATCCGCAATTAGG[A/C]AGGAAACTGGAGGAT TCTGATTATTAGAATTGACAAGATTTCCAATTAGA
solcap_snp_c1_1216 PGSC0003DMB000000072 71785 TCAATATCTTTAATTATTTCATCAAGATTGAGCTC GCTTAGACCAAATTC[T/C]TTGCAGGCTTGCTGA AGTTCCTCGATAGTTATGTAGCCACTACCATCTTT
solcap_snp_c1_1218 PGSC0003DMB000000072 74090 ATTTTGCGTATCAAATCCTTTGCACTATCTGAAAT TCCAGGCCAAGGTTC[G/A]GATTCTAAATCTAGT TTGCCTCGCAGTATCTGACGAAATATTCCCATATC
solcap_snp_c1_1219 PGSC0003DMB000000072 75661 GCATCCTCTTGAGAACTAAGAAACAAGAAATTCTC AGGCTTTAGATCTCT[A/G]TGCATAACCCCTAAT GAATGGCAAGCTTCCACCACCCCAACAATTGTTTT
solcap_snp_c1_1249 PGSC0003DMB000000072 89815 CCTAAAATGGCGGATTCTGTGTATGGCAATGAATT TGGTAGAACAGCCAA[A/T]GCATGTGCTGGAACC ACACAGTATTCAGCTAGACCTCCCATGCTATACAT
solcap_snp_c1_1250 PGSC0003DMB000000072 91775 GGGAGACCACAAACATTCTTGCAGTGTGTGCAAAG CGTTCGCGATGGAGG[C/A]AAAGCTGTGATGATT GGACTTACACTATCTGGTGCTAAGGGTGAGGTGGA
solcap_snp_c1_1251 PGSC0003DMB000000072 93207 AATTTGAAGACGCTCCACAGGCATACAAAGATCTT GATCAGGGAACCATT[A/G]CTGGACGTGCTGTTG TTGAAATAATGTAATTTTGATATTTACAGCAAGCT
solcap_snp_c1_1252 PGSC0003DMB000000072 93251 GACCACCAGAAACAGAAGTTTACATGAATGTCAAA TGAGTGATGAGCTTG[C/T]TGTAAATATCAAAAT TACATTATTTCAACAACAGCACGTCCAGTAATGGT
solcap_snp_c1_1264 PGSC0003DMB000000101 1689255 TGATCCTCGATACCAAGAGATAATCCTGATGTATG ATTAAATTGGTCCCT[C/T]ATCATAAAAACTGAA TGTGGTTGCTGGTATGGTGGGCTCAAGCTTGATTC
solcap_snp_c1_1271 PGSC0003DMB000000392 445445 CAACAACTTCATGGGAAAGGACATCAGGTGCAGGT CAAGGGTTAGATGGA[A/G]TTTTCCTGGGCGGAA GGGGTTTTGGATCTGCAATGGAAGCCCTTTTCAAT
solcap_snp_c1_1286 PGSC0003DMB000000392 369190 ACTGCTGCTCAGCAATATGGGGAGTCTCCGTTTCT AAGTGGCCTGAAATC[A/G]CTGTCTTCCAAACCT TTCCACCGAGTTTGCTCGCACATTATCCGTACAGT
solcap_snp_c1_1301 PGSC0003DMB000000101 738190 GTCATGGGGTTCATCTTCTTGTCTCCAAAATTACA GCTTAACCAAAAATC[C/T]ATTTTCTGAAACAGT GAAATTTTCAGAAAGAACTTCAATATTAACCATTG
solcap_snp_c1_1304 PGSC0003DMB000000101 746939 ATATTCATTACTGTTAAATTCAAGTACAACCAAAA CCTACAAATCTAACA[G/T]AGAATTTTCAACCAA ACATAAGCAACTACCTTTACATTCCCCAAAATACC
solcap_snp_c1_1318 PGSC0003DMB000000101 905577 ACGTCATATTATGAATTTGATAATGGCAGTGATGA CGATGATGAAGAAGA[A/G]GATGACGAAGATGCT TCTTCAGGTACCCCTCGGATGCGTTGTATTTTGTG
solcap_snp_c1_1323 PGSC0003DMB000000101 1102361 TGAGTGATGGACTGTAGATTTTTACTCGGGAGAAT CGTAACAAGATATTG[C/A]AAGACCTGCCAACAA GCAGCGAACAATCAATTTGCTGTTGTTTTAGACAT
solcap_snp_c1_1331 PGSC0003DMB000000101 1244047 AATTAGCTACGTGAATTTTCAACTCGTTGATGAGG ATTTCGAACTTACAG[T/C]GACAGATTTGGAGTA TAATTTCTTTCACCGCATGAAATCCATGAATTTGA
solcap_snp_c1_1341 PGSC0003DMB000000177 930717 TGAGATCCTCCTTTTGGAAAATACATCCAAAAGCT AGCACGCGGACCAAA[A/G]TCTGAATTTCGTATA TCTCGTCTTTGTATAGGTGTAATTTTCCCCACAGT
solcap_snp_c1_1383 PGSC0003DMB000000021 2708210 TGCAAATTCTCACCAGCAATAATAGTCAAGTTTGT AATTATCGGCTTCGA[A/G]TTAAATGTCAGTTCA GCTAATGCCGTCTTATACTGACTCACTAGCTCCTG
solcap_snp_c1_1386 PGSC0003DMB000000603 138041 TGTGTTGCCCAATTAAGTGGCGGAGTAGGTAGGTC GATAGTTCAGGATAG[G/T]ACACGCGCCGCCGTG ATTGGTGGAGGGTTTAGATGACTGCAGTCACCAGG
solcap_snp_c1_1391 PGSC0003DMB000000021 2732209 ATCTCAATCTCTTCACCATTGCGATTTCCGAGATT CAGAGAAGTTGAACC[A/C]ACAACTGATTTCAGG TCACTTGCCAAACAGTATTTCTCGGATTGTCAATC
solcap_snp_c1_1394 PGSC0003DMB000000021 2734410 TGGATCCATATGTCTGGATTGTCTGCTCAGATCTA CAAGAAAATGCCCGC[G/A]TTCCATCTATTGAAT CATTGAGAGCTGTTGATCCCTCTGTAGTACCATCA
solcap_snp_c1_1420 PGSC0003DMB000000679 146793 GGAGGGCAAAATTGGTGCCTGCAATCCCTTTCATA CAATAAATGAAGACA[T/C]TTGATAGCAGAATCT GTCAGAGGTCTAGTTTTAGGACCAGTACTGTGAGA
solcap_snp_c1_1422 PGSC0003DMB000000679 131149 CCTCAAAGTGAGATGGATGAGTTCAAAAGTCAAGC TGATGGACTTGGTTA[T/C]CCATATGAACTTGAC AATCTCAATGAGGCTTTTAACATTGTAGTAGCTGA
solcap_snp_c1_1425 PGSC0003DMB000000603 227418 AAAGGGTCATATTCCAAAGTAGCATCTTCTTCACG TATTGGAAGGTCAGA[T/C]GAGCACCAAGTAGAA AGGAACTCTCCATGCGTGACAGAAAAGATTCCCGT
solcap_snp_c1_1426 PGSC0003DMB000000679 93851 CTTGAAGAAATATTCCAGAAGTTCGGAAATATCTT ATCCTGTAAAGTTGC[T/C]GTTTCTGAGGATGGA AGGAGTAAAGGATTTGGCTTTGTCCAGTTTGAGAC
solcap_snp_c1_1443 PGSC0003DMB000000237 141475 ATCCTTTTCTGAAAGTGGATTTCCTTCACTAGCTT GTTCTTGAATTGCAG[A/G]ACCAGCGTTGCTGTT TTGCAAAACATCTGCTGATTCTCTATTTGTAACTT
solcap_snp_c1_1455 PGSC0003DMB000000237 73515 GGATAGTCATCCACAATTTGACGAATCAAAGCAAA TTCCTCCTCAAGATT[A/G]TCGCTCCATACTTCT CTAATTTGGATAGAATCAGTTTTTGGTAATACAGA
solcap_snp_c1_1458 PGSC0003DMB000000237 255663 AGTATCTGTACTTAGAGAGGCTGAAGACCATATTA AGCTCAAAGACGAAA[C/T]ATTAGTAGTGTGTAA AGCTCTTAGACATGATGGGAAGTTTGTTATCCTCA
solcap_snp_c1_1468 PGSC0003DMB000000137 260277 CGACAATCCACATAAACCTCATCAAGCAATACTTC AAATGCCGATAATTG[C/T]TCTAAGGTGGCTGTG TATTTCTTCCTCTGCTTCTGTTCACACTGTTGTGC
solcap_snp_c1_1470 PGSC0003DMB000000137 406992 CTTCGATGAATTGGTGAAGGAAAATATTGAAGATC TTGGAATGGATTCCA[C/T]TGAAGCCCTTGAAGA CGCTATTCAAACCCTAACTCTCCAAGGCGTTGATC
solcap_snp_c1_1473 PGSC0003DMB000000137 670532 GTCAACTTCTACTGTTATTTCTTAGTGTCTTACTA CTGAACTTTTGGATC[A/G]GATTTTCCTTGTCAT AACCATGGGATCTTACCTGAACTTCAAGAACTTTG
solcap_snp_c1_1481 PGSC0003DMB000000022 2909711 CTTCTAGGAAGTTCACATGTTAAAAGTGCAATGCT AGAGCTTTCAAAGTC[G/A]GATAGAGGGGACGAA ACTGAAAGTGTTAAAATCTCTGAATTGCTCCATGG
solcap_snp_c1_1495 PGSC0003DMB000000022 2679623 TTCTTGCCCTTAGCAAGTGAGTGTACTGAGACGGT CTGCATCTGATCTTG[C/A]TCGTCGAAGTAAGAT ACGGTACCATCGGGGATGACGTCACCAACGGCGAT
solcap_snp_c1_1504 PGSC0003DMB000000066 1365580 AAGTGCAAACCTCCACAGGCTTTCTTTGCTGCTTC CCAAGCTTCAGCTTC[A/G]CTTGTGGATACAGGA TTTTTCTTGTAAGTCGCATAAATGTAGCGGGTAGA
solcap_snp_c1_1511 PGSC0003DMB000000253 201856 CTCCTAATATGTGTATGACCCTCTTAGCTAGTTAT CCTCTTCCGTTCATA[G/A]TTTGTTTAAGTTCCC CTTTCCTATGTGTTTGAGTTTCAACTGTTGTCGGC
solcap_snp_c1_1512 PGSC0003DMB000000430 225416 AGGGTAAGATCAGACTTTTTCCTAAGAGACGAAGA CGATACGTTGTGAGC[T/C]GTTCGTCCATGGCTA CGACCATGGCCATGGCGCATCTCTTTGCTTAATGG
solcap_snp_c1_1535 PGSC0003DMB000001059 8407 ATTGACCACCCAATCCCAGCCATGCCGCCTTGTTT TCTTCCTTCTTAGGA[G/A]CTGCTTCCTCTCTAT AGTAAGGTACTTTTGCAGTCAGCCTATCTTTTCTC
solcap_snp_c1_1536 PGSC0003DMB000000867 15845 TTAAAAACGCTTGGACGATTACATTTTCTGTTTTC CCGTTTACTTCTATC[G/A]CCGTATACTTTTGTG TACGGTTTATTACCTGGTGCACGGCAAGTAACTAT
solcap_snp_c1_1539 PGSC0003DMB000000120 30668 ATCCAAACTATAATTGCTGCTGCTGTTGCTGTTGT GAATGGCACTACCCC[G/T]AGCCAGGGACTACCT TGATGTTTCTCCTTAGGTGAGAAAGCTTCATCATA
solcap_snp_c1_1551 PGSC0003DMB000000348 655823 GGAATATAGGGTTATTACCTATGAGAAGTCCAACT TTGATAACGACTTGA[C/A]CAACACAAATGGTCA TGCAAATGGACATGTCATTGTTGATGCTCAACATC
solcap_snp_c1_1576 PGSC0003DMB000000005 3790353 GAGTTTAGATGGGTAGCTAGTGTTGCAGCAATAAC TTTTGGGGTATCAGC[G/A]GCTTGCCCTCTTTCC CCAGCCCCCAATTGTGATGATTTTTCATGTTCAAC
solcap_snp_c1_1591 PGSC0003DMB000000073 660661 CATCAAGACACTTCATGAATATCTACTTCAGCAGA GTGTTATGAACACAC[G/A]CTAACACTGGATGAG AACATGTTAGGATGAAAGACGCCTTTCAGACAACT
solcap_snp_c1_1638 PGSC0003DMB000000377 126719 GAAGCTGCAGCACTGGCGGATGGTGGTCCCAAATT GTTAATCATCAATGC[C/T]TGCCTCTTAGTTTTG CTCACCATCTTCTTCCAATTGGTCACAAACCGATC
solcap_snp_c1_1645 PGSC0003DMB000000377 108493 ACAATGTCATGCCTAGTTTACCACAAGCAGTGCCG ACAGTTGCAGCGGCA[C/T]CACCAACTTTACAAT CTCAGGGACCTCCAAAGGTGGCTGGTTATTCGGAA
solcap_snp_c1_1653 PGSC0003DMB000000377 50577 CTGTGAAAGGGGCAGGACTCATCGTAAATGGGTCT GCGATTCGGGTCGCT[G/A]ACCCACTTGCCTTTG AAGAGATTACAAGAAGGTGAGATGGGAATTTTGGG
solcap_snp_c1_1683 PGSC0003DMB000000377 3399 GGGATATTCACTTATGTGCTTGATCGCGTCCCTCC AGGCACAGTTGACGT[T/C]ATCCTGTCATATTGT CACTACAGTGTCAACGATTCAACTTTGGAGGATCT
solcap_snp_c1_1684 PGSC0003DMB000000377 3349 TGAAGCAAGCTGGAAAGATCCGCTTCATTGGTATA ACCGGCCTACCTTTG[G/A]GGATATTCACTTATG TGCTTGATCGCGTCCCTCCAGGCACAGTTGACGTT
solcap_snp_c1_1737 PGSC0003DMB000000073 236332 AATCTACCAGATAAACGCTCTATCAGCAATGCAGC TCCTCTAACAGACAT[C/T]GAGGATATTCGTAGG CAGTAGAGTTATAGGTATGTTTTATGTTCTAGGTT
solcap_snp_c1_1739 PGSC0003DMB000000073 242488 TCGATTTTTACAAGTACGATTTTGGATGGGGAAAG CCGATTACGCATAGA[G/A]GTGGCATTGGAAACA TGCTAGAGGGGAAAATAACAGTGTCACCTGGACAA
solcap_snp_c1_1770 PGSC0003DMB000000211 1040716 TAGATCCTAGCTTCTTAGACAGTGGTATCAGTTCC CTCGGAGCTCAATCT[G/A]TCAAGAGGCGAAGAT CTAAGGAAAATGGTTTTCTACAAGGCACTGATATC
solcap_snp_c1_1774 PGSC0003DMB000000631 154142 CCATTTGCAAAAACTTTATCAGGCTCACCCAAGTC TGTTGAACTTTGAAG[T/C]GCTGATTCCTTATTC ACAGCTAATCCATCAGCATTGTTTTGAATAGGAGA
solcap_snp_c1_1775 PGSC0003DMB000000631 154105 AGTGTTTCCACCCCTGGATTCACTAAATTCAAGCT CACCATTTGCAAAAA[C/T]TTTATCAGGCTCACC CAAGTCTGTTGAACTTTGAAGTGCTGATTCCTTAT
solcap_snp_c1_1778 PGSC0003DMB000000631 137458 TCTTTTGTTACTAAATTTCCATCTGGCAATCTTGA CAGACCAGAAGCTTC[C/T]ATTGTAGCATTACTT GACCGGGGTCTCTCACCATCCTGTCGAAAAAACGG
solcap_snp_c1_1779 PGSC0003DMB000000631 137268 CAACAAACTAAGAAGGGGCCGAACATTCTCTTGCT GAGAAGCTGTTGAAG[C/T]AGGAAACCCATATGA TCCCCCTTCCATCTGTTTTGATCCCCTATCAGTTG
solcap_snp_c1_1780 PGSC0003DMB000000631 137197 TGCTTCTCCAGTCCAGGAAGATTGTGATATTCAAG CTGACCCGAGAAATG[G/A]CGAGATGGGGGTTCC TTCTCCAACAAACTAAGAAGGGGCCGAACATTCTC
solcap_snp_c1_1781 PGSC0003DMB000000631 137170 GCATGTAGAAGAGGGAGTATACTTTCATGCTTCTC CAGTCCAGGAAGATT[G/A]TGATATTCAAGCTGA CCCGAGAAATGGCGAGATGGGGGTTCCTTCTCCAA
solcap_snp_c1_1784 PGSC0003DMB000000046 2266036 CAGTTGGGTTTAGTCTCAGATCTTCCAGCCACAGT GGCTGCTATTAAGAA[T/C]CCCAGTTCAAAAATT GTATATGATGACTCCAACCATGAGCGTTATCCACC
solcap_snp_c1_1802 PGSC0003DMB000000236 597170 TTTGCAACATGGTGGGCTTTGAATGTTGTTTTCAA TATTTACAACAAGAA[G/A]GTTTTGAATGCATTT CCATTTCCATGGCTTACTTCTACTCTTTCTCTGGC
solcap_snp_c1_1837 PGSC0003DMB000000105 971988 CTGGGTACAGTTGTTGGAAGAAACTGGAGTGGTGC TCCAAACAATCCGTG[T/C]CGTGTCAAGACCATT CCTCGCCCTATACCTGTGAAAAAGTGGTACTTGAC
solcap_snp_c1_1838 PGSC0003DMB000000105 971269 ACATATTTCCTGCTAAATGCTGAGAATTATCATTG GCAGTGGACTTCATT[T/C]TTCTCAGCATTCTCT ACAGCTGTCTATGTCTACCTGTACTCAGTATATTA
solcap_snp_c1_1847 PGSC0003DMB000000105 935118 CTGTGTTTTTTGAAACTGACTCCATCGAAGGACTC CCATTTTTTATGATC[A/G]AGAACGCTCAAGTCA TCAAGATCTGAAATGGCAAACAAATATTGAGTGAG
solcap_snp_c1_1853 PGSC0003DMB000000105 839901 TCATGGACTGCAAGTTCCATCCTAGGCAACCATGG TTGTTTACTGCAGGA[G/T]CAGACTCTGTGATCA AGCTCTACTGTCACTAAGAAGATTACTCCAAAATG
solcap_snp_c1_1873 PGSC0003DMB000000328 285875 TATAACATCAATTGCAAACGTCTCCTTATAACAAT TCCCTCATTTTTCAA[T/C]TTTTTCAAGTCATCA ACAACTAGGTCCATTTCATTTTCCCACATATCACT
solcap_snp_c1_1874 PGSC0003DMB000000328 286001 CCATAATTGTAATCAAAGCTTTGAGCTAATCTACT TCTCTCTGAATTGAA[T/C]TTAGTTGCCTCAATA AACAAAGGATCATCTAAAGACTCAAATTTGTCATC
solcap_snp_c1_1875 PGSC0003DMB000000328 292754 CCTTGAGGAAAACGTTTCTGAAGCTCCTGAACAGC AAGAAGGATGCTTTG[C/T]CTTGCCTCCAATGGC CGAAGATCCGCAGGAACAGATATTCTAAGCTTACT
solcap_snp_c1_1881 PGSC0003DMB000000328 512654 AACTCGTTCTTGCAACCGTTGGGATCTGTTACATT AGATTTGCCAGAGGC[T/G]CCAGAGAAGGCAGCA CGTCCACCTCCTCAGGCTGTTGACCCTTCCTCTAG
solcap_snp_c1_1908 PGSC0003DMB000000368 468527 GCTTGTAATTCCATATGTCCAGCCCAAGTGCCATC CTTCTCCATGGACTC[A/G]CAATATTCATCAAAT GGTACATCATCTTCAATAAAAGGCTCAAACGTATC
solcap_snp_c1_1909 PGSC0003DMB000000368 510180 TCACCCCTTCATCTCACCCACACCCATCATCATCG TCGTGGTTTCGCCGT[T/C]TCCAATGTCGTCATA TCCACTACCACCCATAACGACGTTTCTGAACCTGA
solcap_snp_c1_1914 PGSC0003DMB000000042 1679678 GCTTACTTTGAAGTTTGCATTAGAACACACACATA CACATGATTATACGA[A/G]CATTATTTAGACTAC ACCAGAGGCGGATATTGCTTGGCCTGCAGCTTAAC
solcap_snp_c1_1918 PGSC0003DMB000000042 1904100 TGATGATCGACCAAAATTACCGGTCGATGGGGTAT CAATATCAACGACAC[C/T]ACCAGCACCAAGGAT GGGAACAGTTCTTGCAATCGGCGGAAACTCTATGC
solcap_snp_c1_1923 PGSC0003DMB000000114 713485 GCTACCACTCCACTTATCTTGCTGCCAGAAATCCA TGTCATTGTAGAAGT[C/T]TACAGGACCAGTCAT TTCAGCGACCCCACAAAACTGCCCACTTGCATTAA
solcap_snp_c1_1944 PGSC0003DMB000000114 823079 CCTTGCTCTTTACTGTACAGTTGAATGAAACCCGT GTCGTTTGCCAATTG[C/T]AGCTTAGCATTTAAC AGTGTTTGGTAATGATCATCTCTATCTTCTAAATT
solcap_snp_c1_1948 PGSC0003DMB000000114 952142 TTGAAGCATGACAATCTTGTTGAGTTGCTTGGTTA CTGTGTTGAAGGAAA[C/T]ATTCGTGTATTAGCT TATGAGTTTGCAACGATGGGGTCCTTGCATGATAT
solcap_snp_c1_1954 PGSC0003DMB000000114 1212018 TTCTTGAATTGGACTAAATCATATTTTTTTCTTGA TGCCTACCCTTATTT[T/C]TCATGGTCACAAAAT ACATCATCAATAAGTCTTGATTATGCACTATTTCA
solcap_snp_c1_1959 PGSC0003DMB000000566 121347 GCAGTGCTTCGTAGTAGCATCCGAGAATTCCTTTG TAGTGAAGCAATGCA[C/T]GGTCTTGGAATCCCA ACAACACGAGCACTTTGTCTAGTGACGACAGGAAA
solcap_snp_c1_1968 PGSC0003DMB000000717 63849 TCTCCCTCTTCCATGCCTTCTCCAACATACCAGTG GACGAATGCCCTCTT[A/G]GCATACATGAGATCA AATTTGTGGTCAATGCGCGAGAACACCTCAGCAAC
solcap_snp_c1_1985 PGSC0003DMB000000114 276202 AGTGCTGTGTCTACTCTAGTTCACTCTGGATTAGA CGTTTTTGCACACAA[T/C]GTCGAAACTGTGAAA CGACTTCAACGTATTGTTAGAGATCCTAGAGCAGG
solcap_snp_c1_2009 PGSC0003DMB000000717 138649 GATTCATTTCCACCGGAAAGACGACGACCCAAAAA GACCTGACCAAAACC[A/G]CCTTTACCTAACTTC CTTTCAACCTGATAAACTGGCGACATTCCTACTTT
solcap_snp_c1_2025 PGSC0003DMB000000717 157116 GGTGATGATGATGATGCGAAAAAATTTAGTTATAG TCTTGAAGTAGGTGG[C/A]TTTGGCAGAAAGTTA ATATGGCAAGGAGTTCCTAGGAGCATCCGTGATAG
solcap_snp_c1_2027 PGSC0003DMB000000717 157977 ATTCAGTCCCTTGTTGCACACCTCAAAGATGATCA CAAGGTTGACATGCA[C/T]GACGGCTGTACCTTC AACCATCGCTATGTCAAATCCAATCCTCAAGACGT
solcap_snp_c1_2038 PGSC0003DMB000000090 468463 CTTTTGTCAAGAAGCAGGAGAATTGCAGCTCATGT GGAGAGGGGATTCGT[A/C]TATTTGAGCTTTCTG AACTTCAAACTCTAAATGATGTGGTGGATTTTGAG
solcap_snp_c1_2039 PGSC0003DMB000000090 468412 AGTTGAAGGATCAAAGGGAAGCTTTTGCAAAAGAA AGGGAGAGGTTTCTT[A/G]CTTTTGTCAAGAAGC AGGAGAATTGCAGCTCATGTGGAGAGGGGATTCGT
solcap_snp_c1_2051 PGSC0003DMB000000090 876873 TCGTCAGCTTTCTGCTGCCAATAGCCCTGCAAGAA AAAGAAAGCCAAGTA[A/G]CCAGGTGGTTGGCTT TAATGATGTGGAGGGTGTGGATGCTGCAAAAGTGG
solcap_snp_c1_2060 PGSC0003DMB000000578 20157 GCAGTGCTTCTTTTCTGCTCCTTCTTCCCAAGACT TTCCACCATGGAGGT[T/G]CCCCCAAGCTTCATT TGGATCATATCCACCAGTGATGGGCTCTTTTTTAG
solcap_snp_c1_2064 PGSC0003DMB000000578 39997 AGATCTGAAAATTTAGTCTCTACGCAGTACTGGAG GATTATAGAGCGATC[G/A]AAGGAGGATTCGGAA TTCGAGAAAGATGATGAACTGAATTCGGGTGCATT
solcap_snp_c1_2065 PGSC0003DMB000000578 81202 ACACTCTTCAGTATAGAATCACCCTTATCTGATAC CTTGTTCAGTCCCCT[G/A]ATCTCAATCTTAGTT TCTGCTGCACCTTTAATATCATTCATTTCCACTGC
solcap_snp_c1_2067 PGSC0003DMB000000578 142035 GGAAATCCAGCAGCTAATTTAGCTCTCAAGTCCTT TCTAAGGATTTTGCC[C/G]GATGGAGATTTAGGA ACAGCATCCACAAAAAATACCCTCTTTATCCTCTT
solcap_snp_c1_2071 PGSC0003DMB000000578 156292 TTTTTAGTGCATCTTCTTCTTTCTTGATATTATTG AACTGAAATGGCTGT[G/A]GCTATGGTTTCTTGT GGAATGCCCACTAGTTTAAAACTTATAGAGAAGCA
solcap_snp_c1_2082 PGSC0003DMB000000578 243780 AGAAAGTAGTGTTGGTCTCACATCAAGCTTCGTGC CATCTTTTAATCGAA[C/T]AGATCATTTGATGAA AAACAGATTCAAGTGCTAATTTAAGCCCAGCTGAG
solcap_snp_c1_2086 PGSC0003DMB000000550 290456 CCATTAGAGTCGGTGTAAAATGTTTTGTTGCTTTT GATGTCAGTTTGAAT[C/T]TGAGTCACCAGCTCT TTCCCAATTCCATTGTCAATAGGTATGGGGCCAAC
solcap_snp_c1_2090 PGSC0003DMB000000550 234594 GAAATTGAAGATGGAGTGATCGGAGAGTTGTCTTT GGAAGTAGAACCTGA[C/T]TTTGCTTTCTTCTTG TCGGATCGGATCGGGGAATTGGACCCAATAGATCG
solcap_snp_c1_2091 PGSC0003DMB000000550 203837 CAACACACAATGACACAAATCAATTTTTCCTGGCA AAGAACAAACCCCAT[C/T]TCTGCTCACCAGATG AACTTCTAACTAGCTTGGCCTTCCAACCTCCAACT
solcap_snp_c1_2109 PGSC0003DMB000000215 1061593 TTCAAAGCAGCACTTGCAGCCGCCATATCAGGAAA AATCCTCCAACATAA[T/C]AATCAGACAGGGAGA TGGTAAACAAAAGTCCAGTAGAGCAGTCAACTACT
solcap_snp_c1_2112 PGSC0003DMB000000180 171652 GAGGGCCTACATCAGTTTGTGACATGGATGCTTCA GCCTCAAGCAACAGT[T/G]CGACCTCGGATAGAT GATATCGTAATCCATGTCGACAAACTGATCTCAAA
solcap_snp_c1_2116 PGSC0003DMB000000215 1077144 GGGCAAATAATCCGGTGATGGATTGCCAAACATAT TTTCAATATTCCTGC[C/T]TCCTCTTCTTCTGCT CAACTCACCTTCTGACTGCCAAACCTCACCTGCTC
solcap_snp_c1_2117 PGSC0003DMB000000215 1077349 TGCTCAAGATTTACAACAATTGCCTTCTCCCTGCC AAGGATTGTTGATGG[G/A]TAAACAAACAATGGA TCTAATAGACGTAGATCACGGGCTGGAAGATCGCA
solcap_snp_c1_2124 PGSC0003DMB000000139 1348928 ACTGCTGGAAAGACGTAACTTATGCTGGCAAACCT CAAACATTTAACTCA[A/G]CTTCAGGGCTCAGTG GTTCAAAGAGAGCTTCCACTTCATTGAGGTTCACT
solcap_snp_c1_2126 PGSC0003DMB000000054 1737416 ATAAACCTCAACCATATCCAAACTCTTAACAGTGA AATGTAGAAATCACA[A/G]CAGCGTTACACTAAT CTGGTGAAGGAAGAAAATTCCAATACATAAGAAGG
solcap_snp_c1_2139 PGSC0003DMB000000152 807185 GGAACTACAGTTAGCACCTCTTGAAGAGAAAGGTT TCTAAATATTAGCCC[A/G]AGTGCATCGGGTAAC AATTCATCCCACGGCCTAAACTCGAATCCTTCCTC
solcap_snp_c1_2162 PGSC0003DMB000000152 572335 AAGTATGTTGGGCTCAAAGGATATGGTCTGGCAAT TTCAGGTAGAGTTCC[C/T]CTGTTGGCTCCTATA ACTAGAGAAAATAAGAGGTACTTAGAGACCAAACG
solcap_snp_c1_2180 PGSC0003DMB000000152 559472 ATCCTTATAAACTTGAAGCTTGCTGCCATGTATTC TGTCGGACATGCTTG[C/A]TAGAGCAGTGTGAGT CTGCAATCAAAAGCCGGGAAGGTTTCCCCATGTGC
solcap_snp_c1_2181 PGSC0003DMB000000152 559464 AAACTTGAAGCTTGCTGCCATGTATTCTGTCGGAC ATGCTTGCTAGAGCA[G/A]TGTGAGTCTGCAATC AAAAGCCGGGAAGGTTTCCCCATGTGCTGTCTTCA
solcap_snp_c1_2203 PGSC0003DMB000000365 297684 GCATTCTTTGAGGAGCATCCAGAGCTTGTAAAGAA CGATTTCTACATAAC[C/T]GGAGAATCATATGCT GGGCACTACATTCCTGCTTTTGCTGCAAGAGTACA
solcap_snp_c1_2209 PGSC0003DMB000000365 512300 ACAAAATCCTCAGCAGTCTCATCCTTCGGAAGAAC TTGTAACTCATCATC[C/T]TCCCATTCCTCCTCT ATAAAAGGTGCCCCATACTGTTCCCCATTCTTCGG
solcap_snp_c1_2212 PGSC0003DMB000000365 232784 GATTTGCCATAGCACATCTAATCAGGTAGAAGATA ATGGAGGGCAGAAAG[T/C]TCCAAAGCATTCTAG AACGAGCAGTATGCCTCCTAAGGATTTGGCATCTT
solcap_snp_c1_2228 PGSC0003DMB000000365 60247 TGTTGAAGCTTCTCATAGGCAATATCATCATCAGC ACAGCATGCATACTG[C/T]TCTTTCAATTTTTCA ACATCAGAAATATTGAGTTTCACTGTGGGATTTGA
solcap_snp_c1_2275 PGSC0003DMB000000152 1141226 TAAAATTTGAACTGGGTCTGTGATGAGCCATTCTT TGATGATCTGAAGCC[G/A]AATAGGAGTAATCAT GTCTTTGCCTAGGAGACCTATGCTCAATTACATCT
solcap_snp_c1_2280 PGSC0003DMB000000365 459393 CATTTATGTTTCTCATCTTCGACACCAGCAAATTG ATAGGTTGGCAGCAG[G/A]TGGACATGAGTGATA CCAGCACTTGATAATCTTTTCAAATGTTGGACACC
solcap_snp_c1_2281 PGSC0003DMB000000365 459390 TTATGTTTCTCATCTTCGACACCAGCAAATTGATA GGTTGGCAGCAGGTG[G/A]ACATGAGTGATACCA GCACTTGATAATCTTTTCAAATGTTGGACACCAGC
solcap_snp_c1_2304 PGSC0003DMB000000152 998388 CTCCCATGACCTTCAAATGCTCGAATCATGTTTTG ATGTTGTTGTTGTTG[C/T]TGATCCCTAGGAAAG AACTGATGATGGTAAAGGTGGTGGGAATGATCCCT
solcap_snp_c1_2314 PGSC0003DMB000000365 439620 AGGAACTTGCAAGAAAAGATGAGGAGATTTTGCAA CTTAAGGATCTATTG[A/G]CTAGAGTTATGAAAG AAAGAGATGAAGCACAAGGCAAATGTCAAAGGATT
solcap_snp_c1_2319 PGSC0003DMB000000057 1946801 AGTGAGAAACTTGGGAGTCCATCAGCTTTAGAGGA TAAGTAGAGTCATTG[C/T]TTTCCCCCTTACACA AGCTACTGTCATCCTCCAGTAAACAGCCAAGATAG
solcap_snp_c1_2331 PGSC0003DMB000000034 1796783 GCAGTATCCTTCTCGACGATAAATTTGAAGTAAGG CTGGGAAGTTTGAGC[A/G]ACGTGTGTGCACAGG AAGGTGATAGCCAGAATTTGATCACAAAGTTTTTC
solcap_snp_c1_2333 PGSC0003DMB000000034 1794967 GCTATTCAGTTGACAGGACTAAGAAGAATTCACAA AGGGAACATGTCTCC[A/G]CAGTTTGCTGTTGAT TCTTTAGTCAATTTTACTCACTTGACATCATTCAA
solcap_snp_c1_2340 PGSC0003DMB000000034 1737631 TTGGAGGACATGCAATCTATTTGGGACCAAGTGAT ATACAGATGGGTAAG[C/A]GGGAAGAAACTCGTG ATGTTGCCCGTGTTCTTTCTCGCTATAATGATATC
solcap_snp_c1_2350 PGSC0003DMB000000034 2218759 GACCAATCCCACAAACTGCATAATAATCAATATCT TGATGAATTGGCTCT[T/G]TTGCTACTTCCCATG AAAGTCCTTTTGTTAGTCTTAGGATTGATGAATTG
solcap_snp_c1_2352 PGSC0003DMB000000561 205503 AATGGATATAACCACACCTACACTCCACCCTCTTC TCTCAGACTTATAAT[A/G]TGTCGATTTCTACAT TAATTATAGAAATGCAAATAAGTAACAGACAGAAA
solcap_snp_c1_2358 PGSC0003DMB000000034 2103931 GGACAGGCAGAGAGGGAATTTAAGGTTGAAGTGGA AGCAATTGGTCGAGT[A/G]CGGCACAAGAATTTA GTAAGGCTACTTGGTTACTGTGCTGAGGGAGCTCA
solcap_snp_c1_2366 PGSC0003DMB000000034 2032516 CCTAAATCTTTGAAAGCAACCTTCAATTCTTGCTT GTTCAATTTTCCATC[G/T]CCTGATTTATCGTAT TTTTTTAGAAGACACTTTAGTTTTTCCTCAGAGAG
solcap_snp_c1_2383 PGSC0003DMB000000034 1913047 GAAATTCTAGATTCCAAGTCATCAAGCAAGATGCG CACAAATCCTGCAGC[A/G]TCTGCCTTCTGACCT GAAATATAACGTTCTGTTATTCCATGCATTGATAT
solcap_snp_c1_2398 PGSC0003DMB000000581 186303 TCACAAGGTTTTGGTAATTCACCATCAAAACTCTG CCTTCTGAATGAGAA[G/T]AGCCTTTTAAGGCTA CTTGTACGAACGTATCTCATCTGCTCTGTTTTTTC
solcap_snp_c1_2404 PGSC0003DMB000000058 647738 AAATTTGGTGTGAAGGATATTAGGGAAAGTGATGA AGAAATGATGTCTGC[T/C]TTGTACCTGCAAGTG AGTATTATCAGCCAGGCTTTGATTTTCGTGACCCG
solcap_snp_c1_2405 PGSC0003DMB000000058 647669 ATTATCAGCCAGGCTTTGATTTTCGTGACCCGTTC ACGAAGCTGGTCCTT[C/T]GTTGAACGCCCAGGA GCTCTGTTAATGATTGCTTTCTTGATCGCCCAACT
solcap_snp_c1_2408 PGSC0003DMB000000058 543672 GATGAGGAATACAAGCACATGCTGTGTGTTGAGGC TGCTGCAGTGGAAAA[G/A]CCTATCACTTTGAAA CCTGGTGAAGAGTGGAGAGGAAGACAGGAACTTTC
solcap_snp_c1_2417 PGSC0003DMB000000172 855550 TGTTTCCCATATATCTGGCATGTGACAACATACGT AAATTTCAGATCTGC[C/A]TGTGCTCTTGATTCA GGAGACAAGTCAAATCCTTGAGTATCCGTAGTTTC
solcap_snp_c1_2424 PGSC0003DMB000000172 45541 ATAAAGCACAACATTCACAGCAAAAATGAAGCAAA CAGTCCCCACAAGGG[C/T]TTTCTGGTAACATGT ATTGTTTTCTCATTTTTGTACGATAAAAACATGAA
solcap_snp_c1_2458 PGSC0003DMB000000105 532134 TCGTTTTCTTGGTGTGAAAGATCAAAGGAAAAAAG TATTCGCATGAAGGG[C/A]CCGTTAGATCGATCA AAAGTAGTGCTGCGGCACTTGCCGCCGACAATTTC
solcap_snp_c1_2459 PGSC0003DMB000000277 455130 TAGGATTCATATGCTTAATACAGTTAAAAGATTCG CTGCTTCAAGACAAA[A/G]TGGTTTGTTTATAAA TTCATGCTTTGCCCACTGCCAATCTGAGAGGCAAG
solcap_snp_c1_2484 PGSC0003DMB000000277 381713 TTTAACTTTGTTGTTTTAACTGACCCTTCAAGATG CAGAATCCCAGACAG[A/C]TGAGTAACATTACCC TCTTGGTCCTTCTGTATCTCTTTCACTATTGCATT
solcap_snp_c1_2519 PGSC0003DMB000000277 51855 AAAATCTTGATAATATGGTCTTTTTGCACCATTAG GACCAAGTGCTGGGA[C/T]AAGACCATCTTCTGG CAGATGGGTGCCTGGGAGGTCTACTCCATCTGCAT
solcap_snp_c1_2520 PGSC0003DMB000000277 51739 TTCTCTCATCATGGGAAGAACCTTTTGAGGCCACC AGATAAGGGGAACGT[A/C]GAAAGAAGTCCTACA AAGCGCCTTTTCAACGAATTACCTAGGTATGGCAG
solcap_snp_c1_2531 PGSC0003DMB000000105 122106 CTATGTTCAACTCTCCTCACATACAAGGCTTGGGA AGCAGAACAAGGAGC[C/T]AATATTGATGTAGAC TCCAGTAACTTGGATGGACTCTCGCCACAAGTTGC
solcap_snp_c1_2535 PGSC0003DMB000000105 195666 CAGGGTAAAGAGCGTTAAATATCCCATGGTACCAT TGATTCAAGTAGCAT[T/C]CCTATAGGCTTCCAT CTCCACAAAGCCCATTTGCTATCAGAGACGCACAT
solcap_snp_c1_2569 PGSC0003DMB000000244 266744 GACTCTCAAAAGTTCACTAAGTGCAGCAAATTTGC AGCAGCCTCGAAGGG[A/C]TGGAAATAGCATTTT TCGGACTTTAAAACAGGTCAAAAACAGCAGCAGTA
solcap_snp_c1_2574 PGSC0003DMB000000244 245949 CTGCCAGAACTTGAGCCGCTAGAGCTGCTTGGATC CTTGTCGATCTGCAC[A/G]GGAGGAAAGTTTTCA CCTGGTATTTCCTCACCAATATCAACATCCTCCTC
solcap_snp_c1_2587 PGSC0003DMB000000244 80711 GAATTTGGTGATGGTGTTGACATAGTCCAATGGGT TAGGAAAATGACTGA[T/C]GGGAAAAAGGATGGA GTTCTCAAGATCCTTGACCCAAGACTCTCAACGGT
solcap_snp_c1_2630 PGSC0003DMB000000244 515474 AAAAATACCATTTCAAATGTAAGTCTTTTTTGATA AAGGACCAGTTCAAA[T/C]ACTAAGAGGAGACAT TGGTACAACAGAAGGCTCAACTGACGTCGACCATA
solcap_snp_c1_2632 PGSC0003DMB000000244 515317 AGTAGGACTACATCTGTAAAAGGCCACATGTATCC CAATACATTATAGAG[G/A]ACTGAGAGCTTCATC TTTCTGTTCATTGCTCTGCTCATCATTTTGGAATA
solcap_snp_c1_2640 PGSC0003DMB000000244 445802 ATAAAGAGCCAGTTACATGCTTTCGTGACATCGAA CATGCATGCCAATCA[C/T]TAGACAGGTCTAATG ATAGCGATGGAAGACTTAACTTGACAATCTTTCGT
solcap_snp_c1_2641 PGSC0003DMB000000244 445790 TCTTAGCAATTAATAAAGAGCCAGTTACATGCTTT CGTGACATCGAACAT[G/A]CATGCCAATCACTAG ACAGGTCTAATGATAGCGATGGAAGACTTAACTTG
solcap_snp_c1_2652 PGSC0003DMB000000244 368914 GACGAATTTGGTTACATGCTTGCTGAGATTTTGAA GGAGAACAACGTCAA[C/T]AGTGATGGTATGCGC TTTGATCCAGGTGCTCGTACTGCTTTAGCATTTGT
solcap_snp_c1_2653 PGSC0003DMB000000244 356428 GACACTCAGGTGAACCCTGCTGTGTGGGAAATTAG TGGACATATAGTGCT[C/G]AAGCGAACAAAGGAT TACAATGATGCATCAGAGGAATATGCATGGAAACT
solcap_snp_c1_2655 PGSC0003DMB000000244 349653 CAGGGTAATTTAATAACTTAGAAACAATCACTCCA GCACCACCCAGCCCC[T/A]TCCTTGCCAGTATTT TCTGTATTGGTGCTTTCTCAACTGGAAATGGCACT
solcap_snp_c1_2656 PGSC0003DMB000000244 349411 CTGTTATAACCTACCCTAAAGAAAGGATCTGCCAC TTCTCTGGCAAAATG[A/G]AGAGCAATTGCGAAA CTATCACGATCAATTCTCTGAGGTAAGCAATCAAG
solcap_snp_c1_2657 PGSC0003DMB000000244 349399 ACCCTAAAGAAAGGATCTGCCACTTCTCTGGCAAA ATGAAGAGCAATTGC[G/A]AAACTATCACGATCA ATTCTCTGAGGTAAGCAATCAAGAACTCGAGGTAT
solcap_snp_c1_2658 PGSC0003DMB000000244 349182 GCAACAATACTAGGTGAAATACCACCGTTTACTCG CATGCCCGAAAAGTA[A/C]TGGGGCTTGTAGTCG GTACTTGGTTCAAACCTGAAAAGCACTTCTTCCTG
solcap_snp_c1_2659 PGSC0003DMB000000244 349143 CCCGAAAAGTAATGGGGCTTGTAGTCGGTACTTGG TTCAAACCTGAAAAG[C/T]ACTTCTTCCTGGCCC ACTTTGGTAAAGTTGAATTTGTTCTCGTCAAAAGG
solcap_snp_c1_2660 PGSC0003DMB000000244 349101 CTGAAAAGCACTTCTTCCTGGCCCACTTTGGTAAA GTTGAATTTGTTCTC[G/A]TCAAAAGGCTGAAGA ACCTTATCAATGCAAAACTCTGTTGGGCGCTTCTT
solcap_snp_c1_2661 PGSC0003DMB000000244 349023 CAAAACTCTGTTGGGCGCTTCTTTAGGTGGCGCCC CTCATTCAGCTGCGC[A/G]ATAAAACCACATCTC CCAGGAATGACCTTCGTCTCACAGGTTGTCACATC
solcap_snp_c1_2672 PGSC0003DMB000000079 1214136 GCTACTTTCGTGATAGTTTCCACAAGTTCCCTGTG GTAATCCGTAACTTG[C/A]GAACTGTATGTCTGA GATTTTCAGCTCAGCTGGGCACCGTAAATGAGCTT
solcap_snp_c1_2673 PGSC0003DMB000000220 495408 TCGCCGGTGTTTTAGGTGAACCGAGTAGTAACAAC AATGCTCTGAACATC[G/A]CTTTTCAGCAACCAA CTCAATGGCCCGGACTTTTGAGTAATCAATTTGCT
solcap_snp_c1_2681 PGSC0003DMB000000018 707712 AGATTTTTCTGGATTGCACCTCTGGGTGCGATGAA TTTTGCTGGCTATGA[G/A]TTAGCAAGGAAAGCC ATGGACAAGGAGGCCACCGAGCAGCTTGCTCAAAA
solcap_snp_c1_2686 PGSC0003DMB000000197 997412 CTAATATCATTGGTAAATCTGGTACCACCATAAAG AAGTTGAGAAGCAAG[C/T]TGAGGGCCAATATTA AAGTAGTTGCCAGAGATGCTAGTGATCCAACACAT
solcap_snp_c1_2687 PGSC0003DMB000000197 997114 GGAAAGAATGGGAAAGTTATAAATTCAATTAGGTC TGAGACTAAGGCGAA[G/A]GTCAAGGTGGTGGAT CCATTTCCAGGTGCTAAGGATAGAGTTATACTCAT
solcap_snp_c1_2689 PGSC0003DMB000000034 626352 CTTTCCGTATTACTTATTGCTGCCGGAGTTCTTAT CGCAGCTCTTGGAGA[T/C]TTTTCCTTTGATCTT TTTGGATACAGTTTGGCCTTTATTTCTGTTTTCTT
solcap_snp_c1_2690 PGSC0003DMB000000034 626136 ATGTACCTTGTGTTGGTTGAGAAGTCAGGAGCAGA GGATGGGCTTTCGTC[G/A]ATTGAGATCATGTTT TACAACAGTTTCTTATCTTTGCCATTTCTGCTATT
solcap_snp_c1_2702 PGSC0003DMB000000034 545822 GAGCACTGGAGGAGAACGCCATTGTGAGGGAAGTC CAAGCAAATGGGACA[A/G]AAGACATCATCCCAA TTGGTATACAGCTCCACCTCCTCCATAGAAAACTT
solcap_snp_c1_2718 PGSC0003DMB000000034 1324325 ATAACACATCGTAGACTCTTTCCTTCAACGAGTAA ATCAAAAGCCTTGTT[G/A]ATGTCTTGAAAACTC ACTTCGTGTGTTACAAACTTGTCTAGTTCCAATTC
solcap_snp_c1_2724 PGSC0003DMB000000034 1213634 TCCTCCGCCGTTAATTCATTTTCCGGTGACAGTCT TCCACCTCATTTTTA[C/T]CCACTTCCCCTAACC TTACAGGATGATAGCTATTTCGAATTCTTTGCTTT
solcap_snp_c1_2727 PGSC0003DMB000000034 1205337 GCGACAATCTTGACCATGTCGTCTCCCATAACCAT GGTTAAAGAGGAGTC[G/A]ATGGTGGTGGAAACA TCACTGCATCGGAAGTCAACTGACACAAGAGGCTC
solcap_snp_c1_2778 PGSC0003DMB000000418 483143 CAGGATGAGAAAGTGGTGGGGAACGAAGAAAGCAC AATGGAAGAAGAGTT[C/A]CAAAACCGGTAAGGG AGAGCTATAATGACTGCGAAATCCCTTTCTCCTCC
solcap_snp_c1_2780 PGSC0003DMB000000418 483088 ACCGGTAAGGGAGAGCTATAATGACTGCGAAATCC CTTTCTCCTCCTTTT[C/A]TTTTCTCCCATTAAA ATGTAGTCTTATGGAGAGACGGAAAATATGTAATT
solcap_snp_c1_2786 PGSC0003DMB000000418 220427 GTAGGAGAACAAAGCCTTGGAGAGGACGAGCGCAT GAAGTTAGGTGGTCA[A/C]GCAGAGAGTTGAAGA GCTTCTCTCGATTGAGTGAGTGGAGTTCCATGGGG
solcap_snp_c1_2789 PGSC0003DMB000000372 89295 CTTTTGTTCCAACAGAAGGACCCTTGCTGCCTGAA AATGCTTCTTTGATG[C/T]AACTCTTCTCTAGGC CAAGGTTCTCACACATTAGTTCTGAAAGATTTTCT
solcap_snp_c1_2790 PGSC0003DMB000000372 89350 TGCTCGCGCAATCCCCTGACCAAATCAGGGCGAGG ACATTGAGGATATAT[C/A]GCTACTTTTGTTCCA ACAGAAGGACCCTTGCTGCCTGAAAATGCTTCTTT
solcap_snp_c1_2791 PGSC0003DMB000000372 89583 CAGGGTTGTAAAAGGTGGCAATGGAAAGTCTATTC CCATCCTTTTCAGCC[A/G]TCACTCGGTGTCGAA TACTCTTATACATCCCGTTGCTCAAAATTTCGATT
solcap_snp_c1_2792 PGSC0003DMB000000372 89671 GTTTTGGAATAGAGATTCAGATAATCTTGAAAGCG GAGGTGACAGGGATA[T/C]AAGAGCTTTGGCGCT GGAGAAATGATGGCCTCACCAGCAGGGTTGTAAAA
solcap_snp_c1_2793 PGSC0003DMB000000372 89740 TGAAGTCTTCAATGCCCATTGGCCAATGTTTTCGC AGACTCAAATCTAGG[G/T]CCTTTTTCAGCAAAT TTGGTTTTGGAATAGAGATTCAGATAATCTTGAAA
solcap_snp_c1_2795 PGSC0003DMB000000372 455657 GTGCAGAAATATTCATCGTAGAGTTGTCTTGGGAA TTGGGGTATCGTTGT[T/G]GTCTCAGTTCATGAG TATGGCTGGCAATGTCGGTGCTAAATCCTTCGTGG
solcap_snp_c1_2796 PGSC0003DMB000000372 455795 TTTTGGTGTCAAGTTACAGAGTCGGCTGCCAAATT TGGCGGGAATTTATC[C/T]ATTTTCAACCCCAAT AACATGTACCAATTCAGTTCAATGTTGTTCAAAGG
solcap_snp_c1_2799 PGSC0003DMB000000580 186891 GTTTATTATTCAAATCAAAGCCGAAAACTCCGGTT GAACTTGTTCGTCAG[A/G]CTCGTGATCTCCTTA TCTATACACAGCGTAATTCTGATATTCGCGAGAGC
solcap_snp_c1_2820 PGSC0003DMB000000072 2002563 GACTTACGGGGTTATGGAGATACTACAGGTGCATC CCTTAACGACCCTTC[G/A]AAGTTCAGTATCCTT CAACTTGTGGGTGATGTTGTAGCACTGCTTGAAGC
solcap_snp_c1_2838 PGSC0003DMB000000072 1823435 GTCAGCAATTGGGATGATATGGAGAAGATATGGCA TCATACTTTCTATAA[C/T]GAGCTTCGTGTTGCA CCAGAGGAGCATCCTGTCCTCCTAACTGAAGCACC
solcap_snp_c1_2838 PGSC0003DMB000000577 67515 GTCAGCAATTGGGATGATATGGAGAAGATATGGCA TCATACTTTCTATAA[C/T]GAGCTTCGTGTTGCA CCAGAGGAGCATCCTGTCCTCCTAACTGAAGCACC
solcap_snp_c1_2839 PGSC0003DMB000000072 1823432 ATTGTCAGCAATTGGGATGATATGGAGAAGATATG GCATCATACTTTCTA[T/C]AACGAGCTTCGTGTT GCACCAGAGGAGCATCCTGTCCTCCTAACTGAAGC
solcap_snp_c1_2839 PGSC0003DMB000000577 67518 ATTGTCAGCAATTGGGATGATATGGAGAAGATATG GCATCATACTTTCTA[T/C]AACGAGCTTCGTGTT GCACCAGAGGAGCATCCTGTCCTCCTAACTGAAGC
solcap_snp_c1_2840 PGSC0003DMB000000072 1823273 GCGGGAGATGATGCTCCACGAGCTGTATTCCCTAG TATTGTTGGTCGTCC[G/C]CGTCATACTGGTGTG ATGGTTGGTATGGGTCAAAAAGATGCTTATGTAGG
solcap_snp_c1_2865 PGSC0003DMB000000072 1673218 AGAGATTATCAAAGCTTTCGAAGAGTTCATCTATT CAGAATTTAAGTCAC[G/A]GTAATGGCGTGGTTT AGAGCTAGCTCAAGTGTGGCAAAGCTTGCTATTAG
solcap_snp_c1_2944 PGSC0003DMB000000087 1055399 GTGCTCCTTCCAACAGCTCCTACACCACCTCTGTA CGGAGCAGCTCCACT[C/T]GTGACAGATTCACTA TCAGATGTCTCTGGTTCCATGTAAAAACGAGCACG
solcap_snp_c1_2953 PGSC0003DMB000000180 1092592 TAATGAGCAGTATAATAGTCGTCTACACATCCAGA TTGGGAGAACTTCAA[G/A]CTGTGTACATACTGC ACAGGTCTTGATGAACTATTAAATTTTTCGACCCA
solcap_snp_c1_2960 PGSC0003DMB000000180 1111797 TAGCCAGATTAACAGAAATACTATACTTCCAACTA GAAGGCACCAGACTT[A/G]AGACACTGCATCTTC ACTACTACCTTTACAGTGAATGAGCAATTTGGAAC
solcap_snp_c1_2978 PGSC0003DMB000000087 1840630 AAACTGAGATCAGGATAGGGCATGTCACAGCAGTA TATCTCCCACAAACA[T/A]ATGCCAAAACTGTAC ACATCGCATTTTCTGTTGTACGGGTTGCCATTGAG
solcap_snp_c1_2979 PGSC0003DMB000000087 1839832 AGTAATATATGTTGTGTTGTTGTGGAATATCTTCC GGGTGGTGCCTTAAA[A/G]TCTTACCTTATCAAG AACAGAAGAAAGAAGCTAGCATTCAAAGTTGTAGT
solcap_snp_c1_3000 PGSC0003DMB000000180 1012938 AATGCTGTTATAGCTTAATATTCATTCTTGGTCAA TTGTAACATATATAA[T/G]GCAGTCAAGACATGA AAGCAGGAAAAGATAAACCAAGAATTCAAAGCAAA
solcap_snp_c1_3001 PGSC0003DMB000000180 1012940 TGCTGTTATAGCTTAATATTCATTCTTGGTCAATT GTAACATATATAATG[C/T]AGTCAAGACATGAAA GCAGGAAAAGATAAACCAAGAATTCAAAGCAAAAA
solcap_snp_c1_3003 PGSC0003DMB000000180 1013031 AAAGCAAAAAAATGTATAAAATATATAAGGCACTT TTAAACGCTGAAGAC[G/A]TTACTACTATGAACT TGTCGCTCCAGAGGTAACTCACACACTCATTATGT
solcap_snp_c1_3011 PGSC0003DMB000000180 1016812 ATTGGTAAAGAAGCAATTGATTCATCCTTAGTCTG CCCCAACAGAGCAGA[C/T]GAAGGATACATGTTG GTTCCCATTCCCAGACGACGCCCTGTTTCTTTTCC
solcap_snp_c1_3012 PGSC0003DMB000000180 1017552 TCCGGAGGACCATGGCAATTCATTGGTCTCCTGCC TTTGTTTGATCCTCC[A/T]AGACATGACAGTGCT GAGACTATAAGGAGGGCTTTGAATCTTGGAGTGAA
solcap_snp_c1_3013 PGSC0003DMB000000180 1018087 GAAATACACTTTCTTCCTTTCAATCCAACTGACAA GCGAACAGCACTTAC[T/G]TATCTTGATGGTGAA GGAAAAATGCACAGGGTCAGCAAAGGGGCACCAGA
solcap_snp_c1_3049 PGSC0003DMB000000028 2620688 CCCCGCTCTGTGTGTGGTTCATGATCAATGCTCAT TTGTATCGCCTTCCC[C/A]CTCTTTGAAAGCACT GCTCTGGAATCTCCAACATTTGCTATCCATAACTT
solcap_snp_c1_3051 PGSC0003DMB000000028 2619719 CTCCTGAATGCCCATCATAAATAGCAAAAAGTCCT AGTTCCCCTTTGCGC[A/C]ACTGCATGAATTTAG CAACATGATAATCCTCCATTGGATGATTTGCTTTC
solcap_snp_c1_3052 PGSC0003DMB000000028 2522202 AAGATGTCTATGGATTTGCTACGTGAACTAGGCCC AAACCTTGGAACAAT[T/C]AGAGCACCTGGAATT GGCTTGCTTTACAATGAACTGGCAAAGGGCATACC
solcap_snp_c1_3057 PGSC0003DMB000000028 1318356 TTTAGCAACAGAAATATACTCGGTAGAGGTGGATT TGGTAAGGTTTATAA[A/G]GGCCGGTTAGCTGAT GGCTCTTTAGTTGCAGTGAAAAGACTAAAAGAGGA
solcap_snp_c1_3060 PGSC0003DMB000000028 530230 TATTGTCATTTGCCGGTGTCGATGAAGACAACCGT CCACCTGAATCTGAT[G/T]TCGACGGTAACAATT TAGCTCTCGGACCATGTTTCGGCTCAACCAGAATA
solcap_snp_c1_3062 PGSC0003DMB000000128 1420066 AACATGTTTAGGATTATGTTTGATAGGAGATTTGA GAGTGAAGATGATCC[C/T]CTTTTTGTTAAGCTT AGGGCTTTGAATGGTGAGAGGAGTAGATTGGCTCA
solcap_snp_c1_3063 PGSC0003DMB000000128 1410364 TTCAGACCTGAGAGGTTCTTCGAAGAGGAGAAGCA CGTTGAGGCCAATGG[C/T]AATGACTTTAGATTT CTTCCTTTCGGTGTTGGTAGGAGGAGTTGCCCCGG
solcap_snp_c1_3064 PGSC0003DMB000000128 1410361 AGACCTGAGAGGTTCTTCGAAGAGGAGAAGCACGT TGAGGCCAATGGCAA[T/C]GACTTTAGATTTCTT CCTTTCGGTGTTGGTAGGAGGAGTTGCCCCGGAAT
solcap_snp_c1_3065 PGSC0003DMB000000128 1410355 GAGAGGTTCTTCGAAGAGGAGAAGCACGTTGAGGC CAATGGCAATGACTT[T/C]AGATTTCTTCCTTTC GGTGTTGGTAGGAGGAGTTGCCCCGGAATTATCCT
solcap_snp_c1_3074 PGSC0003DMB000000128 1347988 ACCTGACAATGATACTTGGGAAGATGAAGAAGACG AGAAACCTTGGAAAG[G/A]ATTATGGCGATCGTT ATCATCATCCTTATAGCTCAGAACATGGTAATCGG
solcap_snp_c1_3080 PGSC0003DMB000000150 620607 GTATTTCGATCGCAGTAGAGAGGATCTGACAGAAA ATGGTGAGAGGAATG[C/T]TGCGTAAACTTGCCA ATCAGTCTCTTTCAGTCGCCGGAAAATGGCAGCAG
solcap_snp_c1_3081 PGSC0003DMB000000150 620604 ATTGTATTTCGATCGCAGTAGAGAGGATCTGACAG AAAATGGTGAGAGGA[A/G]TGCTGCGTAAACTTG CCAATCAGTCTCTTTCAGTCGCCGGAAAATGGCAG
solcap_snp_c1_3096 PGSC0003DMB000000150 215179 AAGCCCCTGGACAAATCATGGCATGTTTTAGGGCT TGGTTATAATCCTAG[T/C]ATCAGTATGGAAGAG ATCAATAATGCTGCAGTTGTCCACTTTAATGGGAA
solcap_snp_c1_3098 PGSC0003DMB000000150 21690 ACCTCAACGTTGGATGATACCGCATCTGAGTGTTC AATGGATGACAACAG[C/T]AACAGATAAACTGGG AAAATTTTCATGTGTGCTGGATTTTTTTTCTCTCC
solcap_snp_c1_3118 PGSC0003DMB000000686 115676 AGAGATGGAGGAAAAATGTGTTATTGGTGCATGGG TGCAGCCTCAAACTC[G/A]TTATGGTAAGGTGGA TATGTGATCATGGAAGTGTCTGAGATGCACTGTCC
solcap_snp_c1_3125 PGSC0003DMB000000686 79176 AGCAATTGCAGTGTTTTCAAGGGTAATTCGGTCCA GATCTGAAACGGCTT[T/G]AATATATATCTTCGA TGGATGACCTAGATATGCTGACCCGAGATTACGGG
solcap_snp_c1_3126 PGSC0003DMB000000686 79138 CTGAAACGGCTTTAATATATATCTTCGATGGATGA CCTAGATATGCTGAC[C/T]CGAGATTACGGGTTT AGACCCGGTGGAAAATCGGCTCCGATGAGATCCGA
solcap_snp_c1_3130 PGSC0003DMB000000686 78644 TGGTGATCTGCTTGGGAATTTGAAGTCGAATGAGA AGGTAACAGAGCCTA[G/A]GAGTAGTACGAGCTC GAGTGCCAAAGAGTTTGATGATTTGTTAGCTGGTT
solcap_snp_c1_3141 PGSC0003DMB000000157 34705 GTGATTATTGGAATAGCTTTGGGTGCTTCTGAAAG TCCCAAAACTATAAA[G/A]CCTCTTGTTGCTGCT TTGACTTTTCATCAATTTTTCGAAGGCTTGGGACT
solcap_snp_c1_3142 PGSC0003DMB000000157 1138727 ATACTTGTTGGTCCCAAAAAGGAACGACTGGATAT TAAGGTGGCATTATC[T/A]AATTCATTTGGATTT GGTGGCCACAACTCATCAATCTTATTTGCTCCTTA
solcap_snp_c1_3144 PGSC0003DMB000000157 776443 CAGGGATGGTCAATTCAGCCACTTTCTGTTGCTTA AGATTCAGTGACAAG[T/A]ACTCCCAAACACCGG GCCTTGGACGTACAGCTAATGCAAGTTGTGGTGGT
solcap_snp_c1_3145 PGSC0003DMB000000157 747792 TCATTATTGAGTGCATTAATTCAAAGTGATTCTAA TCTCCTGTTGCTGTA[G/A]GTACACATGGCAAAT CTACTCCGATCGGCTGTTGACACTAGCTGCTGTTT
solcap_snp_c1_3147 PGSC0003DMB000000157 700020 GACATTTTTGGGAATCACCACAATGCTGTTTGCCT TTTCAGTGTCATGAG[A/C]ATTAAGATTTGTGTT CTGGGGAATTACAGGATTTGACCTGGGATATGCAC
solcap_snp_c1_3150 PGSC0003DMB000000157 647240 ATGTATCTACTAGTTTGGTCCTCGTAGTGAATATG TTCCATGGCAACTTT[C/T]AAAGCCTTTTCTCTC AACTTGTTAAATGGCCATCTTTTTAACATTGGCTC
solcap_snp_c1_3151 PGSC0003DMB000000157 575963 TTGTGTGAGACCATAATGATCATGGTTCTCATTTA AGTCTATAAGTCCCG[C/T]AAACTTTGGAGCCTC CAGCATTTTCCCCTCAAAGCAACTGCAGAAAAAAA
solcap_snp_c1_3153 PGSC0003DMB000000157 462357 AAACAATTTGTTCAAAGGGGACTTGGTCTTCCTTT CCAAGGCATCAAACA[C/T]GGTATTTGTGTGGCT GATCAAATACCTTTGGTTGTCTGCATTACTAGATT
solcap_snp_c1_3154 PGSC0003DMB000000157 399229 TTATCTCTTTATACGACATCGTTTCTCCACCGCTG CTGCTGCTCAGACTT[C/T]CTTTTTACAGCTTTT TCGGTCGATCGGTTTGTTTTCAGACCATATCTCAA
solcap_snp_c1_3159 PGSC0003DMB000000157 311342 AGAAATGTGAGTAAGAGATGAATGATTGTAGAATT GATGGACATAAAAAG[G/A]AAAGAAAGGGGCGGA GGAAACGAGAAACCAAATGTGTAGAAATAACCGTC
solcap_snp_c1_3163 PGSC0003DMB000000157 246521 AAAATACAACATTCAGTACATTAATCAAAAGCTAA TTAAACACGTCAAAT[C/T]AAAGCTTAATTAATA TCCCTCCCTTTTTTCTCAATTTATTGCCATGATAA
solcap_snp_c1_3166 PGSC0003DMB000000184 720117 ATGGCTTCTGTGACTTGTGAAATACATGCATTAGT ACTTCTAGTTTGCCT[T/C]CTCTAGCTCAGAAAT TGGAGCTCTGAACTGCATAGTACATAGTTGGGCCA
solcap_snp_c1_3190 PGSC0003DMB000000040 2307616 TTCCAGTTTTTGATGAAACACACATGCACAAAACA AGCATTGCTTTTGAT[A/C]TGATGAGTGTTAACT TAGCAGACCTACCCATGCTTCCAAGAGTTCTTCCA
solcap_snp_c1_3193 PGSC0003DMB000000040 1410156 ACCCTAAAATATTTCTGCACAAACAATTCTGCACA GCGGCGGAGCCGGAG[G/A]CACCTCTACGGCGAC TTGTCCGATCACATCCAGCTTTCTCTAGTTCCATA
solcap_snp_c1_3199 PGSC0003DMB000000136 936004 TTTGTGTCCCCTTCCGCGAGCAACTGCTAGAGTAT TATGCAAATAATAAA[A/G]GTCCTCCAGAAGCTG AGGAGAATCTCTTAACTTGTTTGGCTGAATTGTTT
solcap_snp_c1_3221 PGSC0003DMB000000105 1261842 AGCAGCAACTTCATTCACAAGTTTCTTTCTACCAT CTTCTAATCGCCTTC[G/T]AATTTCAAGCTTGAT CTCCTCCTTGTTCAAGCTTTCATCAACTTTTCTCT
solcap_snp_c1_3227 PGSC0003DMB000000105 1245416 GATGCTGCAGACTATATGATGTCCATCTGTGGTGA TGATGGTCTGAGAGA[G/A]CTTTCATCTCCTGGA AAGAGTGGCAGCCTTTTCTATCTTTCTCGTGATGA
solcap_snp_c1_3234 PGSC0003DMB000000136 945360 GGATGTTGAGGAGTTGCATATGCAGCCAAGTAATC AAATGTCATGGAATG[T/C]TATAGATACTGAGGA AGATGGTTCCTGTCTGCCAAGCCAGTTGCATGTGG
solcap_snp_c1_3241 PGSC0003DMB000000136 947893 AGAAGCACTAAATCAGCTCACCCAAACTATCTGAA TGACTGCTCATTGTC[C/T]GATTGTTTTCTTACG AGACACAAGAAACTAGCTTCAGCAAATACTGATTC
solcap_snp_c1_3255 PGSC0003DMB000000136 1077371 CAATGAATGAGATCTGAAGGTAACAAGAGATTGTT TGAGCATCGATGAGG[G/A]CAATGGAAAAGAGGC ATTCTCAAATCTTTGAGAAGTGGGGGTGGAAAAGA
solcap_snp_c1_3273 PGSC0003DMB000000136 1121974 GGATAAACAAGCAACCGTTCAGTTGCAGTCATGCA AAAGCCCCATAAACG[A/C]AGTAGATTTCGATGC ACGGCCATACTAATCATTTCAACTTCTGTCTGAAA
solcap_snp_c1_3275 PGSC0003DMB000000136 1122379 TCAAAGAAGTGGTCTTCCGGTTTCCTTCGGCGCCA CCAGGCAAGCAAAAT[C/T]GCAGGAGCTGCAAAC AGAAGAGCAGCCCCTGCAGCAACACCGCCAGCAAT
solcap_snp_c1_3292 PGSC0003DMB000000136 901598 AATTACCCCTTAAATCGGACAACAATGCATGAGAT ATCATCTTTGCTTTC[T/C]CTGACCAATGCTTCG ATTGCTAACTGCTTGGCTGCCTTCTCTGGATCTTT
solcap_snp_c1_3293 PGSC0003DMB000000105 1632964 TCATCTGCTGAAAATTCAGTTGATGGTCCAGATCA GGTTGAGTCAGTTAT[G/T]TCCCAGATAAACAAT CTTGCCATATCTGCAAATCCTGTCGTCCCTCCTTC
solcap_snp_c1_3310 PGSC0003DMB000000018 2235429 TACTAGTGAATCACCAAACACGAAGAAGGCTCGAC TTTCAACTTCAAGCG[G/A]AAGATTACAAAATGC AAGCACTAAAAGTAGTATACAATATGATAAAAAAG
solcap_snp_c1_3311 PGSC0003DMB000000018 2235435 TGAATCACCAAACACGAAGAAGGCTCGACTTTCAA CTTCAAGCGGAAGAT[T/C]ACAAAATGCAAGCAC TAAAAGTAGTATACAATATGATAAAAAAGACAATG
solcap_snp_c1_3316 PGSC0003DMB000000018 1387947 TCTCCCCAAGTAGATGGATCACCGGACCACCAAAT CCGCTGCTTCGTGGA[G/T]CCTCCAAAACCAAAC TCTTCTCCCTTATCATTTGCCCTAATTTCATCATC
solcap_snp_c1_3319 PGSC0003DMB000000018 1905660 AGCCACTCGCACATTATAATTAGCATGGGAAAGAG CTTTGAAAATGCCAG[C/A]GTAATCTGTTCCTAA GTCATACCCGTAATGATCCCAGATGTCTTCAGCAG
solcap_snp_c1_3326 PGSC0003DMB000000097 551610 ACATCCTGGGGTAAGGAGGATAGGTGGATCATCTT GGTAGGGGAGCAGCA[G/A]TACCTATAGTTTTTA GCAGCATTACGGTTAAAGCGGTTGAGATTTGAATT
solcap_snp_c1_3343 PGSC0003DMB000000142 924592 AGACAATGCTTAACACCCTAGATGGAGTTCGTGAT GAAACTGGTGCCAGC[C/T]TAACTCCTTGGGCTA TTTGGACGAGGGCATGGACTGCTGAGGAAAATAGG
solcap_snp_c1_3346 PGSC0003DMB000000142 412671 TTTTGTAGCTTTCAAAGGGGTTGGTTCTTGGTTCT CCGATAAGCACCATC[G/T]TAGGGGCTTAGCAGC TCATCGAGCAATAAGTGGTGATTTGACTGTAAACA
solcap_snp_c1_3347 PGSC0003DMB000000142 1177579 ATACCTTTCTAAAATATCTAAGGTTAATACTGTTG CAATCTCCCTTCCAT[A/G]GGACTGGTTTATTGA TCTTACCTGTTTTATACGTATAAAACTTAATAAAA
solcap_snp_c1_3370 PGSC0003DMB000000202 146357 AAGTATATTGAAGCAGCTGCCAGGACTGGACAAAT CAAGGAGGTTGAGCG[C/T]GTGACAAGAGAATCT AACTTCTACGACCCTGAAAAGACTAAGAACTTCTT
solcap_snp_c1_3371 PGSC0003DMB000000202 153965 CAGCGCTTTCAAGATTTGTTTGCTCAAACCAAGTA CAAAGAGGCTGCTGA[G/A]CTTGCTGCAGAATCC CCCCAAGGCATACTCCGTACGCCGGATACTGTTGC
solcap_snp_c1_3374 PGSC0003DMB000000202 239528 GATGGTTCCAGTATCGTGGACACGAACTTCACAGT TGGAACCATCTTTGG[T/C]GTATGGCCCGGGGAT AAGTTAACCGGGATCACAGGAAGAGAGCAAGTTGC
solcap_snp_c1_3375 PGSC0003DMB000000202 240585 GCTTTCTTTCTAGAGCATCGCGAAAATGCTGTTCC ATCAGGTTATAAAAG[G/T]GAGATAGGTTAAAGA CAACAAGGTCTTGTTAAGAAATGGGAATTGGAACA
solcap_snp_c1_3392 PGSC0003DMB000000202 345467 CAAAGCAAGATAATAAACATTCTCCCCGTAATAAC TTATATGCGCACTCT[G/T]CATCACCTGACAGTA CAGGTTTTGGAAGGACATTGTCAAAGAAATCCTTG
solcap_snp_c1_3393 PGSC0003DMB000000202 345516 ACTAAGATGGTTGAAAGGGTAATAAATATGCGGAA GCTGGCTCCTCCTGC[A/G]AAGCAAGATAATAAA CATTCTCCCCGTAATAACTTATATGCGCACTCTGC
solcap_snp_c1_3436 PGSC0003DMB000000019 2733954 AAGCACAAGGAGATATCAAGTTTAAAACTACCTGT CCTATACAATTTCCT[A/G]TAACATCAAGAGTTG CGCGCTGCAAGTGCTAACTTCTATTTAAGCTTCAA
solcap_snp_c1_3443 PGSC0003DMB000000019 2184084 ATGGATGGTTTAGCAGCTTCTATTAAGGACAAACA TTTGGAGTTAGATCC[T/C]AAGGATAATGAGAAT ATGGGTAGAAACCTAAAGCTGAACAAGGAAACTCG
solcap_snp_c1_3450 PGSC0003DMB000000032 1579018 TAGGTTTTCTTTGGAACAGCCATGATTGATCATCG TCCAAATCTAGATTA[T/C]CACTTGGCAGACTTG GTGGAAGCCAGTTCTCAATCAAATTCTTGTACTGA
solcap_snp_c1_3458 PGSC0003DMB000000032 2541987 TTTCACCAGAAATCAATAGATCTTAAATTTGATCC CAAAAACCTCATCTC[A/C]TTTCCAGCTTAATTG TGATGGCGCTGAACTTGAAGCAGGCATCAATATTC
solcap_snp_c1_3461 PGSC0003DMB000000032 2529495 TCCGTGATGCAACCACTGCAGCAGATCCCTCTGGT GAACACACAATTAAA[C/T]GGTTCTTCCCACACA CTTATGGTCAACCATTAGCCCATTTTCTTAGGGCA
solcap_snp_c1_3462 PGSC0003DMB000000032 2529478 GCAGCAGATCCCTCTGGTGAACACACAATTAAACG GTTCTTCCCACACAC[T/A]TATGGTCAACCATTA GCCCATTTTCTTAGGGCAACTGCCAAGGTCCCTGA
solcap_snp_c1_3476 PGSC0003DMB000000032 2459704 GTCCCCGCTAAAGCATTATTCAAGTTGCATTTTGT TACCCCAATCTTGCT[T/C]GTCACCCCTTTGGTC TGTATTTAGTCTAAATTTCCAGCATTGGTGTATTG
solcap_snp_c1_3478 PGSC0003DMB000000032 2459348 TGCAGAGAATCCCCTGCATCCAACTCAAGGCTCCT GGCAGCCATAGTGGC[C/T]GGTTCTGTATTGGCT GGGGAGCTGTCACTGATGTCTGCCATTGCATCTGG
solcap_snp_c1_3484 PGSC0003DMB000000032 2447717 GCCTTACTGCTAGTGTATGAGAGACCTGAAGCTGA AGGTAGATACTTGTG[T/C]GCAGCTCATACTGTG AAATCAGAAGATTTAGTTGCTATGCTGAAGAAACA
solcap_snp_c1_3494 PGSC0003DMB000000032 2370975 ATGAATTCACCATCTTCAGGAATATCACCACCAGG GACTGAAACGAGAGA[C/T]CCACGTCGAGAGCCA GGGCCTGCCTCCTGATGCAAATATATCCTTTTGAA
solcap_snp_c1_3495 PGSC0003DMB000000032 2369169 AATCACGCAAATAGTAGAAACGACTGCATGAGCCA CACTCCCGAGGTTGA[T/C]AGTGTTACCAATGAC AAGACAGATGAGTGATAGTATGAGAACAGGAATAG
solcap_snp_c1_3497 PGSC0003DMB000000032 2356905 CTGGCATGAATCACCAGACTCTTGGAATCTCCAGC ATAACGAAGTGAGGT[C/T]TCCATTTTGTGTAAA ATGCAGGTGTTCTTCACTGTAGAAGAATTCCCCAA
solcap_snp_c1_3499 PGSC0003DMB000000032 2328954 CTCCGAGTGCCAACACCTAATGTCTCAGTTGTTGA CCTCGTTGTCAACGT[T/C]GAGAAGAAAGGAATT ACAGCTGAGGATGTGAATGCAGCTTTCAGAAAGGC
solcap_snp_c1_3514 PGSC0003DMB000000032 2096540 TAGAGGAAGATGTCAAGACTGAAAATATTGGCCTC CTAAATTTGGATCCA[A/G]CTTTGGAACCTTATC TAGATCACTTCAGACACAGAATGAAGAGATATGTG
solcap_snp_c1_3515 PGSC0003DMB000000032 2096510 GCCTCCTAAATTTGGATCCAACTTTGGAACCTTAT CTAGATCACTTCAGA[C/T]ACAGAATGAAGAGAT ATGTGGATCAGAAAATGCTCATTGAAAAATATGAG
solcap_snp_c1_3522 PGSC0003DMB000000032 2094512 CATTGCCAGGCGGTAATCAAAACCAATTCCTCCCT CAGAAACAGGCCGGC[T/C]AAGGCCCGGCATACC AGAAACATCTTCGGCAATAACAGTTGCGTCTGGGA
solcap_snp_c1_3525 PGSC0003DMB000000032 2092922 ATTATCATCATCCATGCTGCTTACTATCTGTTTTC CTGATGCGAGGAATG[A/G]GAACTTTTCATCGAG CGAATTCATAGCTCTATCAAATGCATTCATAAACT
solcap_snp_c1_3526 PGSC0003DMB000000032 2091800 CAGACACCAAAGGTGGACATTATATGACTATTCCT AGCTTTACTTCAGGG[T/C]GGTTTTAAGTTCCCA TCAACTTCATTTTTGATCATTTACCTAAGTTTATG
solcap_snp_c1_3544 PGSC0003DMB000000032 1888146 GATGGAGTATATGGAACAACATGCCCAATACCCCC AGGGAGAAATAACAC[A/C]TTCAATCTACAAGTG AAGGATCAAATTGGGAGTTTCTATTACTTCCCATC
solcap_snp_c1_3545 PGSC0003DMB000000032 1886592 AAAGCTACTCGACTACTTCAAGATTGGTGGATTCA GAGTTGGAAGCATAC[A/C]GGATTCCCCAACCGG TGGAGGAATTTACCAAGACACGTCTGTTCTAGGTG
solcap_snp_c1_3546 PGSC0003DMB000000032 1886591 AAGCTACTCGACTACTTCAAGATTGGTGGATTCAG AGTTGGAAGCATACA[G/T]GATTCCCCAACCGGT GGAGGAATTTACCAAGACACGTCTGTTCTAGGTGT
solcap_snp_c1_3553 PGSC0003DMB000000032 1862161 TCTATGAGAGGACGGGGAACAAGGATACGCTTCAA CATCTTCTCCATCAG[C/T]GACAAGTATCCCTCG GTCGACATAATGAAATTCACAGCCAGAAAAGGCAT
solcap_snp_c1_3557 PGSC0003DMB000000032 1839272 TTGTATAGTAGGAGAAATATGTAAACTAGAAAAAC TTGAGGAAGTAAAAA[T/A]AAGCTCGCAAGTCGA GCATTTAAATGTGAAGGATAGATGTTGAAAATACC
solcap_snp_c1_3596 PGSC0003DMB000000021 943819 GAAGAGTCGAAGAGGCGAGAGCTTCAAAAGATGAC GGAAGATGCTGAGCA[A/G]AAGCGCATTGCTGCT GAGTATGAGCAAAGGAGGAGCCAGCGAATTTTGAA
solcap_snp_c1_3597 PGSC0003DMB000000021 943756 GCTGAGTATGAGCAAAGGAGGAGCCAGCGAATTTT GAAGGAAATAGAGGA[C/A]CGAGAACTTGAAGAG GCCCAAGCTATGCTGCAAGAAGCTGAAAAACGCAG
solcap_snp_c1_3598 PGSC0003DMB000000021 942616 CAAGAAAGAGTTGTTAGTAGCCGGGAAGCTGAATT CACTAGATTGAAGCA[G/T]GAGAGACGAGAAAGG ATCAGCCAGATAATTCAATCAAGGAAGCAGGAGAG
solcap_snp_c1_3608 PGSC0003DMB000000021 455545 AAGGAAGTGGTGGATGAAAAAGAGATGAGTGCTGT CACTGAACATGAATC[G/A]AATGAATTCACTACG TTGAAACATAGATTTTTGAATTTCAAGAAGGACAA
solcap_snp_c1_3612 PGSC0003DMB000000021 419073 AGAGGGAATCTACAAGCTGCCTCTCTTCTTTAGCA GCACCAAGATCTTCA[G/T]GTGACATAGAGGAAA TCCCCTTAATTCGCTCCTGGAGTATTTGCTTGAGT
solcap_snp_c1_3613 PGSC0003DMB000000021 419052 TCTCTTCTTTAGCAGCACCAAGATCTTCAGGTGAC ATAGAGGAAATCCCC[T/C]TAATTCGCTCCTGGA GTATTTGCTTGAGTTTCTCATTTTCTTCAATTGAT
solcap_snp_c1_3616 PGSC0003DMB000000019 3078595 TTGGAAGATGAGAGCTTAGAAGGTAGCTGAAGAGA TCCAAGACGAGAGGA[T/G]CCGATATCGGAGGAC GACGGAGCTCCGAGAAATTGTTTGGTAGGTACAAA
solcap_snp_c1_3637 PGSC0003DMB000000093 402243 AGAAGAGATGGCAGAATCTCACTAGCTTCTGAAAC AACAAGTTTGCCCCC[G/T]CCTACATTGAATGTT GACCAGCTCACCCAAAACTTCAAAAATATGGGACT
solcap_snp_c1_3638 PGSC0003DMB000000093 401892 AAGTTTGGTGGTGCCAATGAACCCTGTAAGCCCAG CTATCACTGATGAAT[G/A]TTACTACACCGATAT TCTGGCCAACAGGGGCTTGTTTACATCCGATCAAA
solcap_snp_c1_3639 PGSC0003DMB000000093 401817 CAGGGGCTTGTTTACATCCGATCAAACTCTTCTCA CAAATCCAACTACAG[C/T]TATCCAAGTAATACA AAATGCTAGGTATCCATTCCTCTGGAAAAGTAAAT
solcap_snp_c1_3647 PGSC0003DMB000000450 12952 CCCACTGTACTGGGTACTAAACCCAAGGTGTCAAA TGGCCACTCAGCTGT[T/G]CTTTTAAATGGTGAT CGTATATTGGTTATTAAGGGAAATTCCAAGTCTGA
solcap_snp_c1_3662 PGSC0003DMB000000450 213349 TTGCGTTCCAGTGGGCTTTCATTCTCATGCCTAAT AAGTTGTAACTTGTA[T/C]CGTGATTTTGACTCT GATTCAAGAATGTGTAAATTAGAACAGCATATATT
solcap_snp_c1_3663 PGSC0003DMB000000450 213132 TTACAATTTCTCCATCATCACTGTACAACTGCTGA AGCACCACGAAAGAT[A/G]TGTCCCTTCTTTGAC AAAGGTAAGCTTGCATCCTTAAGTATTTCTCTCTC
solcap_snp_c1_3687 PGSC0003DMB000000156 497320 CCGAGGAGAGCAAGAAGGACAAGAAGAGAAAAAGG ATGAGATAGAAGGGA[G/A]AGAGCAAGTACGCCA GCAAGTAGGGTAACGTAATTGACGCGAAAGTAGGA
solcap_snp_c1_3689 PGSC0003DMB000000156 487171 CATTTGTGAATGGGCTGATCTTTCCTGAGGATGAT TTCCCTGGGGATGCT[G/A]CAGGAGCAGCAGCTG TTGATGAAATGGATGTTTTGCTTGCACTAGGTGGT
solcap_snp_c1_3691 PGSC0003DMB000000156 305765 TCAACATCTGCTTTCTGATGTCTCTTCAAGGTCTG AATGACAAGTCTTGA[A/C]GCTTCTTCAGGTGTT TTAGGAGGAGGCTTTGTTTCTCTCCACGCATCCGA
solcap_snp_c1_3693 PGSC0003DMB000000001 4622220 AGACTAAGATGGTTGAATTATCTCCGGCCCGATGT ACGACGTGGAAATAT[A/C]ACTCTTGAAGAACAA CTTTTGATTCTGGAACTACATTCTCGTTGGGGCAA
solcap_snp_c1_3694 PGSC0003DMB000000119 1348630 CTGGCATACAGTTTAACTATATTTCGATGCCTGAT CTTTCCTAGAATGTC[C/T]ATTTCCCTTGTCAAA ACTTTCACCTCATTTCCTTTCCAAAGCTGCTTTAC
solcap_snp_c1_3696 PGSC0003DMB000000224 276205 TCCGGCTGTTTGAAAAGAAGAGTTTTAATAGAATT AGTGTCGTGAACGTT[A/G]TACCTCTTTCACCAG TTGATAGGTGCTGTGGTATGTTGTCATTGTAAATC
solcap_snp_c1_3707 PGSC0003DMB000000355 42190 AGGTACGGTATATTAATAAGTCTTGTGCAAGGACT TGGACTTGGCTTCAC[G/A]TACGGGCTTGCAATT TGTTCCTGTGCCTTGCAACTGTGGGTTGGAAGATT
solcap_snp_c1_3722 PGSC0003DMB000000355 557620 GAAGCAAAACTTGGTTCCAAAAATGTAGGAAAACA GGATTACAGAACAAG[C/T]GAACAACCAACCACT TTCTCGGTAGAACCTTACATGTTTTTGGGATCAGC
solcap_snp_c1_3740 PGSC0003DMB000000355 580885 TTGTAAGTGGTCATGTTAAATATTTTTAGCTTTGT GTAGACGCCCCAAAA[C/T]CTCTTCGGTCTCACT TGATTTGGGTTTGCCAGTAAACTAATTTTCTCCAC
solcap_snp_c1_3746 PGSC0003DMB000000120 810704 TACTTCTTGGTCATCACCTTGAACAACAATTTCCG ACAAGCTTCCATCAT[C/T]TGCTACAATCATTTT CACCTTGATCTGCTCCTTTCTGGATGCTCGAGTCC
solcap_snp_c1_3747 PGSC0003DMB000000120 810585 AGGAGTAAGTTTCAGACATATATATCTTACAAGAA AACCAAGTTATATCA[C/T]CTTTCAAGTAAGCCC TTAACATAAACCATGCCTTTTTCACTCAGCTGTAG
solcap_snp_c1_3750 PGSC0003DMB000000568 105979 AATGCTAGTCTGCAAGTGAATGCAAATGGGGAATC CGATGCTGCTCTTCA[T/C]CAACCCGGAGCTTCA CGGAGAACTCCTTTCACCGACCTTAGTCAGGTCGA
solcap_snp_c1_3753 PGSC0003DMB000000120 969863 ATATTTCCTTCAGCACGAACGATCAAATAAGAAGC TGCTCCAAATGACTT[A/G]TCAGAATGATAACCA CAGTGGTAAACACCCTGAAAGTTGTAGAAGACTCT
solcap_snp_c1_3767 PGSC0003DMB000000051 112619 AAACTGTAAACTTGGGGTACTTTTTCAATGGGAGA AAGTGAAAAGAATCG[A/C]GAAACCAGAGATGGG TTTTGTAGACATTTCACCCCTGCTTCAAAATCGCT
solcap_snp_c1_3793 PGSC0003DMB000000051 1040462 CTAGGTAGTAGAAGACTTCTGCCCAAACACGTTCG GCAACTTCGAGGGTT[T/C]GTTCTATTGGGTGGT CTCCATCCAAAAGAATCTCAGGTTCTACTATTGGC
solcap_snp_c1_3795 PGSC0003DMB000000051 1032910 GCAATTAGTGAGAACTCAGAGGAAAGTTTCAGGAA CATAATGTCTGAACC[C/A]TCTCCTGGAGTTTTT ACGTTCGAAATGCTTCAACCACGATTTTGTGAGAT
solcap_snp_c1_3803 PGSC0003DMB000000051 916380 CATGAAATCGGAAGACTGTTTAATAAAGCATGTAA AAGCAGAATTACAGC[A/G]TGGAGGGCGATGACC ACATATTTGGAGGCCTGATATCCGCCACCATTTAA
solcap_snp_c1_3840 PGSC0003DMB000000051 465706 ATGACCTGGAACCAGCCGGTAATTAACTTCCTTGA CGAATTCTGCCTTCC[T/G]GAGCAAGAATTGTAT GCATCATCTAGAGAGAAGTTTGTTTTTTTCTGGAG
solcap_snp_c1_3844 PGSC0003DMB000000010 1064443 ATGCTGACCAGAATCGCATTCAAACACATATGGAT TATGTGTTTCGCAGT[C/T]GTACAATAATCACGT GTACGAACATAATTCTTAAATGCCTCTCCAAGCTG
solcap_snp_c1_3848 PGSC0003DMB000000010 2084232 ACTATGATGGGTATTATGGTAGGTTTTTCCTGAAT TGGTACTCTCAAGTT[A/C]TGATTGACCATGCAG ATCGCGTGCTTTCTTTGGCCAAGTTAGCTTTTGAT
solcap_snp_c1_3850 PGSC0003DMB000000010 2087048 TGTTGATGCGGATGGTCTAGTGAAGCAGTTGAGAG TGCTAAAATCAATAA[A/G]TGTCGATGGTGTGAT GGTGGATTGCTGGTGGGGCATAGTAGAGGCAAATG
solcap_snp_c1_3851 PGSC0003DMB000000010 2087878 CATATACCTACACAACATACTCCACCTGGTTCGTT GAAAGATGTGCCTTC[C/T]GGGTTTCAGAACACA GACGATCAGAGTGCCTGTCAAATGAAAAGTGTTTT
solcap_snp_c1_3852 PGSC0003DMB000000010 2087888 ATCATCTTCACATATACCTACACAACATACTCCAC CTGGTTCGTTGAAAG[A/G]TGTGCCTTCCGGGTT TCAGAACACAGACGATCAGAGTGCCTGTCAAATGA
solcap_snp_c1_3853 PGSC0003DMB000000010 2088359 AGATGTAGGCCATTAGAAGAGAAGGAAAGAACAAA GCTTAGGGAGCGACA[G/T]CGAAGAGCTATTACT GCAAAGATCTTGGCTGGACTCCGAAGGCATGGGAA
solcap_snp_c1_3854 PGSC0003DMB000000010 2088487 ACGATGAAGAGAAGAATGCTGCCATGCATGCAATA GCAGGTTTTGATGGG[G/A]TACATGGATCTAGCA GCAGTAATAGGTTTCAACACCATCAGCAATATCAC
solcap_snp_c1_3860 PGSC0003DMB000000010 985502 TCATGCAACCTCCAAACAACTAAAATGGATAAAGA AGGCGGAGGTTTTCC[T/C]AAGTGGAACGAGAAA TTGATCGTTGATTTACCCATGCATGCGCGTCATCT
solcap_snp_c1_3863 PGSC0003DMB000000010 985700 GATTATTTGCATTTTTTGAGTTATAGGCTTAGGAA TGAAAAAGGGGAGAA[G/A]AATGGGATAATTAAT TTTTCTGTTAGGGTTAAGAATGCGGCGCCCCCGTC
solcap_snp_c1_3867 PGSC0003DMB000000010 1215312 CTCTCCTCTAGCTTCTCATGACAAGGGACTTTGGA TGATCGATAGAAGCT[A/G]GTGATGCTGAGTTGA ACACCTTCCGGTGATTCTGAATTCTCAGACTTCAT
solcap_snp_c1_3868 PGSC0003DMB000000010 1215573 TGAGACACCTTTTCTGGAAAAGCATTCTGTACAAG CACCATATCTTCTTC[C/A]GTTGACAAAAAGCTG CATCCCTCCTTGACATGAATCTGCGGAGAATCAGG
solcap_snp_c1_3876 PGSC0003DMB000000010 1254269 AACTGAGCAGCCCGATACAATGTGGTTCCCTTAAG CTCTAAAAGCTCGTC[T/G]TCAGAAAACCAAAGT GGATTTCCGAATGTGGTTGGAAGCATATCAAAGTA
solcap_snp_c1_3894 PGSC0003DMB000000010 1397334 TGTACTAGTATATCCATAATTAGAATTAGAAATTA AAGACCCCAGCCATG[A/G]ATGATGTTACTCTCA ACAGCCATGCTCCTTGACCCTGAGGCTCCATCTGC
solcap_snp_c1_3895 PGSC0003DMB000000010 1419984 AGGAACAAAAGTGCTGGATCTAGCTTCCCAATTGT GATTCTTATCTTCTG[T/C]TCATTCCTTGCTCCT TTGATTTTCTTTGTTGGACGTGGCCTCTACACCTC
solcap_snp_c1_3917 PGSC0003DMB000000010 1686292 AATTCAGAGCCGATGTTGAAGTATCTCTTAAGCTT CCAGAATGGATCGAC[A/G]TAACGCCAATATGAC AATGCATTTGAATCATCAAAGGCCTTGATGAATTT
solcap_snp_c1_3992 PGSC0003DMB000000133 1176679 GGAAAATCGAAAGTACCGTTTTTCGGTGAAATTTT TGGGGCTTTGAAAGA[T/A]TTACCTCGACCGATG TGGATTCTTCTATTAGTAACCTGTTTGAACTGGAT
solcap_snp_c1_3993 PGSC0003DMB000000133 1173910 TTTGGAGGAGGAAACTTGCCTGGATTTGTAGTTGG AGCAGTTGCAGCTGC[C/G]GCGAGCGGTGTTTTA GCACTCACAATGTTGCCATCTCCACCTGCTGATGC
solcap_snp_c1_3996 PGSC0003DMB000000133 781230 CAAAAATCTCCATTTTTGCCTCAAAAACCCCATTA TACACTCTTCAACTT[G/T]GCTGTAATACGAAGT TTTCTGGTTCTACAATGCTCGAATGGCTCAGTACA
solcap_snp_c1_3999 PGSC0003DMB000000133 1154710 AATACAAAGTCCTTATCAAATAAGTTCACTTTCCT TGTCCACTTACGGAC[A/G]CGCAAAAAAGCAGCA TGGCCATCAAATGCACTGTTCGGATCTTTATCCAT
solcap_snp_c1_4000 PGSC0003DMB000000133 679403 AGAGCAATACATGCTGCGACCTTAGGACCAACGCC AGGTAGAGAGCACAG[T/C]GAAACAATGGCCTCA GGAAGATCGACTTTGCGAAGTGCAGCAAGCCACTC
solcap_snp_c1_4005 PGSC0003DMB000000133 532579 AATGCTAGCTCATCTGCTAGCCAGACGAAATCATC AACGTCAAATTCAGA[G/A]CACACATCCAACGAA GTACAGAAGCCATCAATTGGCTCTAGAGCTACTGA
solcap_snp_c1_4005 PGSC0003DMB000000237 398730 AATGCTAGCTCATCTGCTAGCCAGACGAAATCATC AACGTCAAATTCAGA[G/A]CACACATCCAACGAA GTACAGAAGCCATCAATTGGCTCTAGAGCTACTGA
solcap_snp_c1_4029 PGSC0003DMB000000096 806195 AACATTAAAAAACCAAAGGGTGTCATGTTCAATTA TACAATTTCAAGGGT[G/A]CTATCCGGGCGTCAT ATTGATAAGCCAGTCAATATTGATTACATTCCATG
solcap_snp_c1_4044 PGSC0003DMB000000096 706540 ATCATTCCTGCTGGTGTGCCCCGAAAGCCTGGTAT GACCCGAGATGATCT[G/A]TTCAACATTAATGCG GGTATTGTTAAATCTCTTTGCACGGCCATTGCTAA
solcap_snp_c1_4076 PGSC0003DMB000000207 1087233 GATCGGCTTTTGAAACCACCAAAAGCAGTTCCCTT CCAAACACGACCAGT[T/C]ACCAGCTGAAATGGA CGTGTAGATATCTCCTGACCAGAAGCAGCAACACC
solcap_snp_c1_4077 PGSC0003DMB000000207 963798 AATGGTATGAACTCTGAGTGAAAGCTTTGTGGTAA GGGAGAATGAAATAC[C/T]AGTTTTTGATACGCA GACGGCAGAGCAAAGGACAAGTGGAAGACGCCAAT
solcap_snp_c1_4078 PGSC0003DMB000000207 962196 GAAAGGAATTCATCAGGCAACTTAAGTGCTTTAGC AAGCCAATCCAGAAC[G/A]ATCATTTCGAGTTCT GTCGCTGCTGGAGAAGTTATCCAACTAAAGCCCAC
solcap_snp_c1_4082 PGSC0003DMB000000207 906313 TCATGAAGCAATTGAAGCTATGGATTTTTCGAACC AATCTCTTGAAGAAA[C/T]GGATAAAGATCCTTC GCCTGATGGTTCTGCTTTAGTGACTAAAAAATGTG
solcap_snp_c1_4083 PGSC0003DMB000000207 906266 AAACGGATAAAGATCCTTCGCCTGATGGTTCTGCT TTAGTGACTAAAAAA[T/C]GTGATTCAGTCGAAA AGAGTATTGACAGTCTTGCAAAAGAAGTACAAGAA
solcap_snp_c1_4084 PGSC0003DMB000000207 906150 GATCAGAAGGCAATCAAAGAGAAAAAGAAAGCTAA AAGATTGAGAAAAAA[G/A]CAGCTTGTTCAGGAA GAGGAACGGGAGAGGGGAAAAGTTAGCATGAAAGT
solcap_snp_c1_4085 PGSC0003DMB000000207 906126 AAGAAAGCTAAAAGATTGAGAAAAAAGCAGCTTGT TCAGGAAGAGGAACG[G/A]GAGAGGGGAAAAGTT AGCATGAAAGTTTATCTGTCATATATGGCGGCTGC
solcap_snp_c1_4086 PGSC0003DMB000000207 905823 GTTGCTACATTTGGTCTAGAGGCTGCACAAAAATT ATTTTTGAAAATGCT[G/A]AGAACAATCTTTAGG GCTCCAATGTCTTTCTTCGACTCCACACCAGCAGG
solcap_snp_c1_4087 PGSC0003DMB000000207 903031 TATATGGCTTCATCAAGGGAACTAGTTCGCATTGT TAGCATCCAAAAATC[T/G]CCAATCATTCATCTT TTTGCTGAGTCAATTGCTGGAGCTGCAACAATCAG
solcap_snp_c1_4088 PGSC0003DMB000000207 902950 GCTGGAGCTGCAACAATCAGAGGTTTTGGACAAGA AAAGAGATTTATGAA[G/A]AGGAACCTTTATCTC TTGGATTGCTTTGCTCGACCATTCTTCTGCAGTCT
solcap_snp_c1_4089 PGSC0003DMB000000207 902271 CTGTCACGATGGATACTCAGTTTCTGCAAGCTTGA AAACAAGATTATTTC[A/C]ATAGAAAGGATTCAT CAATATTGTCATATTCCTAGTGAGGCCCCACAAAT
solcap_snp_c1_4090 PGSC0003DMB000000207 902209 TCATCAATATTGTCATATTCCTAGTGAGGCCCCAC AAATTATTGAACCTC[A/G]TCCCCCATCGTCATG GCCAGAAGAAGGAACCATTGAACTGATTGATTTAA
solcap_snp_c1_4091 PGSC0003DMB000000207 861068 ATTATGCGGACTCCACGAGACTGGGACAGGTTCAT GAGATTTATGGAGCG[G/A]TATGCTAATTCAAAT GGCTTGCAATTTGTTAAAAGTTGAGATTATATTGT
solcap_snp_c1_4109 PGSC0003DMB000000032 332807 GGAGGTATGGGTTGTAGTGCTGGTGTAATTGCCGT TGATCTTGCCAAGGA[C/T]ATGTTGCAAGTGCAC AGAAATACCTATGCTGTTGTTGTTAGTACTGAGAA
solcap_snp_c1_4140 PGSC0003DMB000000032 151684 CTGATCAGCAACTTACTAGGATTTGTTGATGAGAG GGATGCTGTCAGTTC[C/A]AACGATTCTTTACTG AATTTGGTGAAGAGATTTATCGCATATGCAGCATG
solcap_snp_c1_4162 PGSC0003DMB000000754 95073 ATCATGCCTCACGTATGGCGCGTACTTCTTCTCTA ATTCCTCAATACTAG[G/A]GCTTGATGACTGCGA TTGAACTTGGAGTTGAGGGTTAGTCGGGTCGGGTT
solcap_snp_c1_4171 PGSC0003DMB000000754 39344 AGAAGCGAGAGTAATACGTAGAAGGCGAAACCCTA AACCGGGTATAAGAA[T/C]GGTTGAGGATTCGAA CCGGGTCGATGAAGAAGGCATTTGAGTTCAGCTCA
solcap_snp_c1_4172 PGSC0003DMB000000754 26272 TGAAAAATTCATCAGATGCGAAGCTCTGGCGACTT GTATTCTCCGAACTA[G/A]ACGAATCATGTGATG CTCCATCAATAAGATCATCCAATTCCAGGTAGTCC
solcap_snp_c1_4175 PGSC0003DMB000000633 208310 TCCAGCTGCTGCAAGATACTTAACTCACTAGGTGC ACAGTGTTGTCCTGA[T/C]ACATCATTTTGAAGC ACATCTTTGCAAACAGAGAGACTAGGAAGAAGCGT
solcap_snp_c1_4178 PGSC0003DMB000000633 121532 GGGGAACTTCTGAGAAGGCAAAGTGCTGCCAAACA CTCATCCAAATGGTT[G/A]AAATTTATGCGTATT GAAAGAAAACTTAGCTCGTCACAAGGCGTAGGTAG
solcap_snp_c1_4180 PGSC0003DMB000000633 78354 GAACCTGTTATGTTATCTTCCGAATTCGTCCATCT ACTTAGCCTAAGTTG[C/T]TCCAATTCAATCGCT ACTTCCATCATCGATGGCCTCATATCGCGATGAAA
solcap_snp_c1_4192 PGSC0003DMB000000476 194476 TGCCATGAAGATGTAATTGTGGGCACTGCCCCATT GTTAAGAGCATCAAC[G/A]AAGGACTGAGTTATA CGGGCAAATATCGGCCCTGTCATTACAGTAGCTCC
solcap_snp_c1_4206 PGSC0003DMB000000071 437217 AAGCCATTTTTACAAGATAGGGAAAAGAAGGTGTT GATGATTGTGATTCC[G/A]CTTCAGGTTTTGGCT AATGTGGCTTCGGTCGTTATTGGTGAAACAGGTCC
solcap_snp_c1_4213 PGSC0003DMB000000071 438672 ATCATCATCGACATCCTAGCAATTGAGCATCGCCA ACAGGGAAACAAAAC[G/A]TAGATTATCTTGGAG ATGGATGAGATTACTGAAGAAGTCGCACTGTAATT
solcap_snp_c1_4222 PGSC0003DMB000000071 521513 ACTATACACCAGTTTGAGATTGTTGGGAATTCCAT AAAAATACGCAAAGA[C/T]ATTATAGAAAGGACC ACCAAAGTCTCCTAAAACCGGGCAAGACTCCACCA
solcap_snp_c1_4228 PGSC0003DMB000000071 683159 TCAATTTTCCTGGAGATGGAATTAATTCTATGAAT TGCAACTCCGATTCT[C/T]GAATGAAGATCCTTC ACAACAGCACGCGTCTTGTCAATCCTCTGAGGAGT
solcap_snp_c1_4231 PGSC0003DMB000000742 46531 TACCGTAGCCAAGGAAAGTTACTGGAATTTGATTT ACCGGGAGGCATCCC[C/T]GAATCATGGCCTAAG TTGCTGGAAGTTCTCAACCTTGATGAACAGGAATA
solcap_snp_c1_4237 PGSC0003DMB000000742 64768 CAACTGTATGTCTCCGAGCTCGACCGCATTGTTCT CAAAGACAAATCATC[A/G]GCTCGCAACTTTGGC AATGTGTCTACTGTTCGTAAAGCAACAATTACTCT
solcap_snp_c1_4238 PGSC0003DMB000000742 93135 TTATCGCTGAAAATATCAATCTTCTCTCCTTTTCG CTGAATATTCAGATC[G/A]TGAGAGAACTTGCAC TTAAAACCCTTAACACATTGCCCCGCCTTAAAGAA
solcap_snp_c1_4243 PGSC0003DMB000000742 143625 GGTACATTCGATAAGCCATCACTGAAGAAGAAGGG ATATTTGTTGCCAAG[G/A]CCAAAGATGGTGAAT GCTGATCTTGCCAGGATTATCAATTCTGATGAGGT
solcap_snp_c1_4248 PGSC0003DMB000000371 33862 CCTTTCTTTCAAAGTTCTTGGTCGCTTCTTCAAGT TCAGCTAATGTAAAG[T/C]AGTGTGCTGCTTCTG TTGCAGCATCTCCCAAGGAAGAGACAAACCTTTGA
solcap_snp_c1_4271 PGSC0003DMB000000371 221786 GCATTTGGGCTTATCATTTCTCAGTTTATCAATGA AATTATCAAGAAATC[A/G]GTTCAGCAAGCCCGA CCCGAAACTTGTGCACTTCTTGAAATGTGTGATTC
solcap_snp_c1_4282 PGSC0003DMB000000071 418510 GGCACTCATGATTCTGACAGTGTAAGCCTTCAGAA AAGTGACTTGGACAT[A/G]GAGCACAATGCTTCA GATAGTGCAAGAGACCATCTTTTTGTGAATGATGA
solcap_snp_c1_4296 PGSC0003DMB000000148 616220 CATGAGGAGATTTTTACGGATGATGATGAAGCTGT TGGGAATGATCCTGA[G/A]GAGAGGGAGGATTTG GCTCCTGAAATTCCTGCTCCTCCAGAGATTAAGCA
solcap_snp_c1_4319 PGSC0003DMB000000148 939591 GCTCGTGTTTCTGATTTCGGGAAAAATGACACAAT ATTCTCCGTAAGAAC[A/G]CATCTAGGCCATCTT CTAGATGCTGGAGACTATGCCCTCGGTTATGATTT
solcap_snp_c1_4322 PGSC0003DMB000000148 939924 AAGAGCAATATCGTCAATTATAAGTACACATTCTC TGTAGAAATCAGCCC[A/G]GTTTGTCGTGAGGAT CTGATATGTCTCCCTCCAAAGGTGGCAGCTAGTTT
solcap_snp_c1_4328 PGSC0003DMB000000148 940359 AAGAATTTGAATAAAGTTAAGTTGGTGAATGCCGA GTTTATTTGGACTGA[G/A]CCTCATTCGAAAAGG ATCAAAATTAGGCTTAAAGTCCAAAAAGAGGTACT
solcap_snp_c1_4336 PGSC0003DMB000000148 1042744 CCGGCAGTAAAACCTTTATCTGACCTGCTTGGTAC TTGGAAAGGTGAAGG[T/C]GAAGGCTTTTTCCCT ACAATTTCTTCCTTCAATTACTCCGAAGAACTCCA
solcap_snp_c1_4347 PGSC0003DMB000000148 1163793 GGGAGAGCTCCTTTGACCTGCTTAGCATCTGAACC AGAACTCACTTTTGA[T/C]GTCGGTCCATTTTCA CCAGATCGTTGATCTTCCCTGCTTCTAGTCTCAGC
solcap_snp_c1_4359 PGSC0003DMB000000217 392881 ATGTACAAGTCATCCATGTCATCATCAATCTCCGT CTTTTCCTCCACAAT[T/C]AAAGGTTTAAACCAT GATGCCCTGAGGAGAAGGCAAACACTCTCCTCAAA
solcap_snp_c1_4371 PGSC0003DMB000000217 108946 TTCATATGCTTTTCCCAAAGATATTTACTTGTGCA TTTCTCCCTCAAAGA[A/G]CTACAAACACTTGCC ATACTATAAAGTCCCTCAGGTGGGAGCCTCTCAAG
solcap_snp_c1_4376 PGSC0003DMB000000387 26381 GAGACCTGATCCAGCAAAATTGGTTGATGAGCTAA GAAGTTCCTCTCCCC[G/A]CCGTGGCTACTATTT TTAGTGTCCTCTATAAGAACCCTTTCCAAAACTGG
solcap_snp_c1_4378 PGSC0003DMB000000387 64449 GATGAATATGGGAGAGAGAACTATAAATGGAGAAG GCATGGATCACGCAA[C/T]GCCATTTCAAGTCGA AGGTCAAAGAGTCTTAGCAAGAATTATAGAGTATG
solcap_snp_c1_4415 PGSC0003DMB000000068 1043158 TTTCTTCTTGGATACTCATCACGAGGGCCCTCCAG AAGCTACGCAGGAAT[T/C]GCAAAGCCAGATATT ATGGCTCCAGGGGCACTTATTCTTGCAGCAGTTCC
solcap_snp_c1_4444 PGSC0003DMB000000159 282023 CCAAAATTAGCTTCCACGGCTGAAGACGACTTGGA AAGGATGATGAGAAT[T/C]GCTGATGCTGAAAAA CAAGCAGAGAAAGACCTTGCAGCCTTACTTGAAAG
solcap_snp_c1_4454 PGSC0003DMB000000033 1053750 ACAGTAGTCCTAATTCTTTCCTCTGTGTGGATAAG GAAAAGTGGTCAACC[G/A]ATATTTGGACCAACA AGTGCCAGGAAACTTTTGGTCTTAAGAGCTCTCAG
solcap_snp_c1_4455 PGSC0003DMB000000033 793891 TCCAAGGAAAGCATTCACCATTGATTTATGAAAGG CTATATATATCAAGA[C/T]TCTTAACATTCTTTC TCGAACCCTGGGACGCTCGTTTTTATTTGGTGCTT
solcap_snp_c1_4464 PGSC0003DMB000000033 477634 TACATGATATTATAAAAATTGATTGAGGACATTTT TCATCAAGAAATTGG[C/T]GATGATGAGATTAGT TTTTTGGGAGAGATGGAAAGAATCCCAAAATACAT
solcap_snp_c1_4486 NM NM ATGTTGCAGCCCCAGTCTTTAGCCGCTTTCAGCAC AGCAGTCATGGGATG[C/T]AGTCTTCATATTCTT GGCGATGATGGGTTTCCTATANNNNNNNNNNNNNN
solcap_snp_c1_4489 PGSC0003DMB000000065 1151004 TGCACGAGGCTGATAGGATTAATGTACAAGCCGAT TATAGAAGAGATGAG[T/G]TACATGATGATCATT TACATTCCCCTGTTCGTAGGTGAGGAAAAGGTGGT
solcap_snp_c1_4502 PGSC0003DMB000000065 415500 CTCCTGCAGCGCACGCCTTTCAGCTTTGGTGGTCT TCTCTTTCAGTGACT[T/C]TGCATTTCTTTCTAC TTCAGTTGGTGTTTCAGCCACTAGTGCATTGACCC
solcap_snp_c1_4504 PGSC0003DMB000000055 678718 TGTTTCCCATTTTCTTGGGTATTACATGGTGTATT TAGTTTCCTATGTCT[G/A]CAGCACCAATATAAT CTATAGCCTCTTTTGATTCGTACAACATTTTCTCA
solcap_snp_c1_4509 PGSC0003DMB000000055 678337 GTTGAAGAGAAGGATGAAGTGATCAGTAAGCTGAA TGAAGAGTTGAATGA[G/T]AAAAACACTGTTGTG GAGAAAACCGAATTAACTCCTGATAAAACTGCCAA
solcap_snp_c1_4519 PGSC0003DMB000000055 598429 TTTCAGGCCCATTAATCAAAAAGAAAAAGGCACCA GTCTCATTTGCCACC[G/A]CTCTTCCAATCAGGG TTTTCCCCGATCCTGGAGGACCATACAGGAGAATA
solcap_snp_c1_4542 PGSC0003DMB000000055 500061 TAGTTGATCTTTACTGCTCGCTCTGCCCTCAGAAG CACTTCTGAATAGAA[G/A]CAAATCTTTCAGTTT CCATTTTCTGTACCAGAGTGATATCGATGATGAAA
solcap_snp_c1_4576 PGSC0003DMB000000695 166537 ATTAAATCTTTATTGCTCATGAATGTTAAGGATTT CATATCAAAGCAAGT[T/C]TTAGTCTTTCTTCCT TCAGAATCTGAAATATGTGGTGAATTAACTTTGTT
solcap_snp_c1_4577 PGSC0003DMB000000695 166266 GCTAAGTATCTCTCAGGATTAGGTATTGCACGACA ACGTCAAGCAATTGT[G/A]GATGGTCTGAGAGAC AGTGTGCTAGGATTTTCAGTCAATGTGCCTGGAAC
solcap_snp_c1_4579 PGSC0003DMB000000695 138215 CGAAACACGCAGTACTGGGATTGGTGAGGTCTGCA AGTAAAGGACTGGGT[G/A]CGTATGGTATACGAG TGAACTGTGTTTCTCCAGCAGCAGTGGCAACGCCA
solcap_snp_c1_4579 PGSC0003DMB000044495 68 CGAAACACGCAGTACTGGGATTGGTGAGGTCTGCA AGTAAAGGACTGGGT[G/A]CGTATGGTATACGAG TGAACTGTGTTTCTCCAGCAGCAGTGGCAACGCCA
solcap_snp_c1_4595 PGSC0003DMB000000092 48384 CACTACTTCAGCTAGCAAACGTATGCTCTCTCCGA TCTCCCACCCTTCCA[C/T]GGCCCTCTTTCGCTT ATTCTTTGATCTCAATTTTGACTTGCTCTTGTTGT
solcap_snp_c1_4604 PGSC0003DMB000000092 112323 AGGGAAATAATAGAAGACCTGAGATCTGCAAGTGA GTTAGAAATGCAGGG[T/C]GGAAGGGGCAAATTA GGTGCTGATACCAAGACCCTACTTAGGATCCTGTG
solcap_snp_c1_4615 PGSC0003DMB000000092 206990 ATAAAGAAAAGAATCCTCACCCTCAGGAGATAATA GAGTTTCCATCAGTA[A/G]TAGTGAGTAGCACGA CTGGCCAGCTGGAAGCTTGTTTTCAAACTTACGTG
solcap_snp_c1_4617 PGSC0003DMB000000092 209796 GGTTTCCTTGCTTTGGACCTGGTTTTCGGAATATC CCTTTGCTGCTCCTT[G/A]CTCCACAGAAACAGT AGGGCTGATTTTGCAATACTGGAGAAGGCACGTCT
solcap_snp_c1_4622 PGSC0003DMB000000092 214594 ACATAAAAGGTAATTATTAATAATTTAATACACAA CATCCATTCTTCAAT[C/T]TCACCATTGTTACTT GCAACGAATACCACCTTTCTCTCCAACTAATTGAA
solcap_snp_c1_4666 PGSC0003DMB000000092 596036 GAGTGATGTATCACCCATTATAACAGGAAAGGTGA CCACATGAGGCCTTT[C/T]AACAACAACAAGGAA ATAAAAACTTGAAGATGTTCGATAGCTGGAAGTTA
solcap_snp_c1_4680 PGSC0003DMB000000109 1547603 TTTCGAGAAGTGAAGGCCTACAAGTTGCAATCTCT TGCTCGTTCAGCTGA[C/T]GACTACTATTTTGGG CTGTGCTATGGCTTCTGTTTCTAGCAATGGGAATA
solcap_snp_c1_4688 PGSC0003DMB000000109 1554057 ACTGATAAGCAAGAAGTATCAAGTATCTTTTTCTG GGCAAACCCTTTAAT[A/C]AAAAATGGGGGAAAA ATTCAAAGCTCCATCAGTTTCGGTATCTTCACTTT
solcap_snp_c1_4695 PGSC0003DMB000000068 1686276 GTGACAAAGAAGGCATGGAATCCAAATGGAACTCT TTTAGGTAATTCAAC[A/G]ACTGCCACAGGTTCA GCTGACATTGTTTTCGCATCAATTACATTCACTGA
solcap_snp_c1_4706 PGSC0003DMB000000068 1769604 AGAACATTAAGGGTACTATAAGTTACAACATTGCA TCCATCTCAATGGGG[C/T]AAAATATGAAATTCG TATACATCAAGCAGAGTTCCTATCTGGGGATAAAA
solcap_snp_c1_4744 PGSC0003DMB000000068 1462430 CGGCGAAGATTTTCCGATGAGAAAAATGAACCCTT TTCTTCAAAGATTTA[A/G]ACCATTTTGGGATTT TTCTCTTCCACACCTAGAAAGAGAGAGAAATTTGC
solcap_snp_c1_4745 PGSC0003DMB000000068 2083634 ATGAAGCATCACATGTCGCGTTCTAACACCAGTTC TAGGTTGGCAATCTC[T/G]GAACTTCCGCAAAAA GTTGTTTCAGAGTTGTCAATCATGGTTGCCGAGTT
solcap_snp_c1_4748 PGSC0003DMB000000608 223314 GAAATTGATCTTCAATGTCAGGAGAAGTTCAGATG AGTTCAGAAAAGCAA[C/T]CACGAAGAGGAGTGT CATGCACCACTTACTTCGATGCACTCTGGTTCTGC
solcap_snp_c1_4752 PGSC0003DMB000000608 146042 GTTGCTTCTGAACCAGTTTTATTTGGCCTAGGATC AAGAACAGTTGTGGT[G/A]CTGGAATTGACATAA AAAGTTTTGGTTGTTCCAGTAATACAATACTTATT
solcap_snp_c1_4757 PGSC0003DMB000000608 128202 TTTTGACTCGCACCTATATCCCCTAACCTACCTTG TAAGCACTGTGCCCT[G/T]CCCTCACCTCGAGGC TCCTGCTGCAGCCCCTTTATCATACTCCCCTTGCT
solcap_snp_c1_4763 PGSC0003DMB000000608 106324 CATATACTCCACTATATAGTACTTCCGTACCATGG TGATTGAAGCCACAA[A/G]CCGCTAACATGGAAC CAAGGTCATCCACCAGTGAACTGGATTCCGATTCT
solcap_snp_c1_4774 PGSC0003DMB000000369 391964 TATTTACATGACTATGCTGGGATATGCACCAGCGT TGGGTTGACAGCAAA[T/C]CCCATTGTCAACTTC TCTGGTGTCTTGGGAACCAATGTTCTTGCTCTAGG
solcap_snp_c1_4775 PGSC0003DMB000000369 84914 TCAATTTGAGAGCTATCTAAAGTAATATCCCAGTC AATCCCATCAGCTAC[G/A]ATGTCAGTTTCTACA GTTATTTGACTTAAGCCATTATAGCCTGCTTGAGC
solcap_snp_c1_4776 PGSC0003DMB000000369 84834 TATCGCTAGCATTAACAATCTCATAGGGACCCAAA CCATTTCCATTTTCT[T/C]CTGTTTCTTCCACGG TGCCAATGTCCCAATCAATTTGAGAGCTATCTAAA
solcap_snp_c1_4777 PGSC0003DMB000000369 84586 CCTGTATTCTGTCTCCAGTAGAGGACTCCTGTCAT GGATAGCTACTGGGT[C/T]GGCAGTTAAATTATT TTGAAGAGAGTGCAATTCCGCAGCATTATTTTGTG
solcap_snp_c1_4778 PGSC0003DMB000000369 52463 GGTGCAGCTTGTAAACAAAGGTTCGTTCGTGCCAG GATCAAGCTTCCTCC[G/T]TTTCTGATCTAGTCC AGGAACCACAGGTATTCGGGCAAAGGATGTGTAAG
solcap_snp_c1_4779 PGSC0003DMB000000369 52446 GTCCCAAAATGATCTCTGGTGCAGCTTGTAAACAA AGGTTCGTTCGTGCC[A/G]GGATCAAGCTTCCTC CGTTTCTGATCTAGTCCAGGAACCACAGGTATTCG
solcap_snp_c1_4781 PGSC0003DMB000000369 39637 TCAACCCCACAGGATGCCAGATAGGCATGTAGTTC ATTATAAAAGTTGAA[G/C]ACCTTTTTTGGGTGC ACTAAACCTAAGCCATGAACTGCAAGACTATCCAT
solcap_snp_c1_4782 PGSC0003DMB000000369 34072 GTGCCTGGGGATGCATCATGAATACGTGTCTTCTT TCTCGCCTTGCACCA[C/T]CCAGCACCTTGGCAG TTAAATACACCAACCACACCACTGCATTTGTTCAC
solcap_snp_c1_4782 PGSC0003DMB000000545 315927 GTGCCTGGGGATGCATCATGAATACGTGTCTTCTT TCTCGCCTTGCACCA[C/T]CCAGCACCTTGGCAG TTAAATACACCAACCACACCACTGCATTTGTTCAC
solcap_snp_c1_4783 PGSC0003DMB000000369 34058 CTGAAGTTGTAAGTGTGCCTGGGGATGCATCATGA ATACGTGTCTTCTTT[C/G]TCGCCTTGCACCACC CAGCACCTTGGCAGTTAAATACACCAACCACACCA
solcap_snp_c1_4783 PGSC0003DMB000000545 315941 CTGAAGTTGTAAGTGTGCCTGGGGATGCATCATGA ATACGTGTCTTCTTT[C/G]TCGCCTTGCACCACC CAGCACCTTGGCAGTTAAATACACCAACCACACCA
solcap_snp_c1_4784 PGSC0003DMB000000369 33369 TCCTGCACCGTACAAAGCTTTCAGCCAGCCACTTA CAATAGATTCTTCTG[T/C]CTACTTAGACCTGAA TTTCAATATTCCATTTGTACATCTCTTGTTGTGGA
solcap_snp_c1_4784 PGSC0003DMB000000545 316630 TCCTGCACCGTACAAAGCTTTCAGCCAGCCACTTA CAATAGATTCTTCTG[T/C]CTACTTAGACCTGAA TTTCAATATTCCATTTGTACATCTCTTGTTGTGGA
solcap_snp_c1_4789 PGSC0003DMB000000716 46620 TTGAATGGAATAAGTTTTTCTAAGGCTTCCACTGA TGCCTCAACATCAAC[G/A]TCTTCCTCACTAGCT TCTGACTTTGTCTCAGCGCTGCTTGTCCATTCTTC
solcap_snp_c1_4792 PGSC0003DMB000000183 891587 TGCCACGGCTTGAAACTGCTACATAACGTCCATCA GGAGAGCGATTAACA[G/A]TACTGAAAGTTCCTG TATAGTAACTGGCACCACTAATGCCACTAGAAACT
solcap_snp_c1_4794 PGSC0003DMB000000183 790425 GTTTTTGATGAGGAGGAGGAAGAAGAAGATGTTCT TCGTAATTTGCAAAA[C/T]GAAGCTGCTGAGGAA TTAGCAATAGAGCATACACCTGCAACAGGTGATAA
solcap_snp_c1_4796 PGSC0003DMB000000377 429899 ATTTAATTGCTCCAAGAGACCAACAACAGTGAGCT TTGAATCCACATCAA[T/C]GGTGGATACATCCTC GCTAAATGTTTCCCAAGTGCGCAGTTGTACGTTTG
solcap_snp_c1_4799 PGSC0003DMB000000377 154170 GCTCATCAGCATAAGAGGAAGCAGCGCGGACAGTA AGAGAAGTGGCATTG[G/A]TGGGATGGCAACGGA CCACTGAGACGGAAGGCTGACGAAGGCTTTGCCCC
solcap_snp_c1_4800 PGSC0003DMB000000377 566236 GGAAAGGAGATTTGGAAGAAGATGGGTGATTGATT TGTGTATACCAAAAA[T/C]TATGAGGGTTTTGCT CGATTTTGAGACCGTCGAGAAGATGTCCAGGGCTG
solcap_snp_c1_4803 PGSC0003DMB000000290 106339 GCTCCGGTAAAATTTTGGTGCACTAAATTCCCGTT ATGTGCGAGTGAATA[G/T]TAGGCGTGGAGTGAA ACAAGGATGGGATAGCTCAAGATGAAGCAAATTTG
solcap_snp_c1_4814 PGSC0003DMB000000268 528979 GCCCCCTAATTCCAATCCCCATATTAGAAAACCTA GAAAAATCAATTTCA[C/T]TCCTCCGCCGTCTGC CGGCCCTACTCCGCCGTGACGGAACACTTGTGTTG
solcap_snp_c1_4817 PGSC0003DMB000000169 5813 AAAGTTCTAGGAGATGGAGGACCCCTTGAATGGTT GTATTGAAATGGGTC[T/G]GAGTTGTACCTCTCT CCTTTGTGTCTATCCATGGAAATTGGGTTCACGAA
solcap_snp_c1_4822 PGSC0003DMB000000367 223102 ACCCAATAGTTTGCATGCTGCTCTGATATTGAGTA AAAAACCTCATGCTC[G/A]TATACTTTCGATAGA TGATTTGGGAGCCAGGTCCTCTCCTGGATTTGCAG
solcap_snp_c1_4823 PGSC0003DMB000000367 226805 TCAAAAAGTTGAAGACTGTACCTTGGGGCGTCTCT GGGATGAATTGAAAT[C/T]TTCTTGTGACTTCAT TAATGCTCAAAATGAAGTTGAAACTTTCAATCGCC
solcap_snp_c1_4824 PGSC0003DMB000000367 287236 AACAAGAACCAAGAAACTACTGTATTTTATGAGGA AGATGTTAGACGGAA[G/A]GTTCGTTCTCTGAGT TGGGCACCTATTGTGTATTCAACAGCAATAGCTGG
solcap_snp_c1_4826 PGSC0003DMB000000004 1332778 TCCTTCAAGCAATTATATGCTGCTTCTGCAAACTT GTTTAAGCACTCTGG[C/G]GCAATTTGTCCTTCC AAATTCGGATCAATTATTTGTTGAAGATTTCCTTT
solcap_snp_c1_4847 PGSC0003DMB000000004 1490580 GCCTATGGTGCATCTGAAGAAATAGGGCCATTCAG GATAAACAAGACGGC[A/T]TCAGGGCTGTATGTG AACAAGTTTTCATGGAACAAATTGGCAAATTTACT
solcap_snp_c1_4849 PGSC0003DMB000000004 1492861 CAGCTATCAGGTTATGATCCTTGCACGGAGAAGTA TGCAGAAATTTACTA[T/C]AACAGGCCTGATGTG CAGAAGGCTATGCACGCGAATACAACAGGAATTCC
solcap_snp_c1_4850 PGSC0003DMB000000004 1492879 CCTTGCACGGAGAAGTATGCAGAAATTTACTATAA CAGGCCTGATGTGCA[G/A]AAGGCTATGCACGCG AATACAACAGGAATTCCTTATAAATGGACAGCCTG
solcap_snp_c1_4859 PGSC0003DMB000000004 1569220 GAGCATATGATCTTTAAGGGTACCGAAAAGAGGAC TTCTTGGGAAATGGA[G/A]GAGGAGATTGAGAAT ATGGGTGGACATTTGAATGCCTATACTTCCAGGGA
solcap_snp_c1_4860 PGSC0003DMB000000004 1569334 CTGCGCGTGGCCACGGAGACTAATCTCGCTGTCAA GACTGCCACCGTTGG[G/T]GTATTCATTGATGCA GGGTCAAGGTTTGAGACCGATGAGACTAATGGAAC
solcap_snp_c1_4862 PGSC0003DMB000000004 1569469 AAGCTGAGGATTGATGTGTGGTCGGCTAAAGTTGG GTGTGGTGAGTTGTA[C/T]TGAAGGAATCGGGAA TCAGGATTCTCGAGTCTTTTGATCTTTTGTTTAAC
solcap_snp_c1_4873 PGSC0003DMB000000004 1618275 ATCACTCAGCAAGATTTTACGGAAATGGCATGGCA AGCAATTGTTGCATC[G/A]CCAGAAATAGCGAAA GAGAACAAGCATCAAATAGTAGAGACTGAACACTT
solcap_snp_c1_4881 PGSC0003DMB000000004 1630161 TCCTGTGTTTGCAAATGGTTTGATGATCTCGCAAA GAGAGTGCTCTGGAA[G/A]GAGTTTTGTAAGACG AGAGCTCCAAAAATGATGCTTGATTTACAGTCTAG
solcap_snp_c1_4885 PGSC0003DMB000000004 1661841 GTAACCTTTTGCATCCTTCTCATTAAGCTTATACA GTGATAAACTTTGGG[A/G]AGGAACTGGAACAAG AACATTAATAAAAGGATCGTCATTATAAGCTTTAT
solcap_snp_c1_4925 PGSC0003DMB000000017 675212 AGCCGAACAGATCTGTAAACCCTAAAATTGAATAG AGAGATTCGAGACGG[G/A]GAGCTTTTTCAAGTT TTGTTTTATTTTGTTGAGCCAAACCCTAGGTTTTG
solcap_snp_c1_4926 PGSC0003DMB000000017 675155 GGCGAACAAGACGACAGGACTGGAAGCTTCCAAAA CATATTTGAATCAGA[G/T]ATTAACAGCCGAACA GATCTGTAAACCCTAAAATTGAATAGAGAGATTCG
solcap_snp_c1_4942 PGSC0003DMB000000017 521346 TCTACTGATAGTACAAGCCTCATTCAGGCTTACCA GACACCATCCATGAT[G/T]GACATGGTTAGCCGA TCACAGACAATGTACCTCGGTAGTCCAGCTCCTCG
solcap_snp_c1_4947 PGSC0003DMB000000017 520766 AATCTCTTTCTTCATCTGCATATAAGTCTCCAACT TCAATATTGCCACTT[T/C]TGTTATCAGATGCTA AACTAGCATTGTAACTTCCAGCTTTTATTGAATTG
solcap_snp_c1_4949 PGSC0003DMB000000017 520387 AGCTACACTAGGACTGTTAATGGTATACGTGTCTT GTCCATCAGACAACA[G/A]TATTATGCTGCTAAC TGGATTTTTCCACTTGCGATCAGTCATGATCTTGG
solcap_snp_c1_4951 PGSC0003DMB000000017 520275 AGGGCCTCGGCAATGTTTGTCCCACCATTAGAGCT GAGTGAATTCACGGC[C/T]TGTAGTGCTTCTTGC TTGCCAGTATCGCTCATCCTACGCAGAGGAAAGAG
solcap_snp_c1_4989 PGSC0003DMB000000008 2049684 CAGGCTTTCGCTCAGACGTTGCAACAGTCCAGAGG TTTCGGTTCTGAATT[C/T]CGATTTTCCGAGACC AGCACTGCAGGGACAACTGGAACTGCTGCTGACCC
solcap_snp_c1_4990 PGSC0003DMB000000008 2050048 CTTTCTAAGGACATCGATCTAAGAGCACTTGCAAA GTATACACAGGGCTT[C/T]AGTGGAGCTGACATT ACAGAGATCTGTCAACGTGCTTGCAAATACGCTAT
solcap_snp_c1_4992 PGSC0003DMB000000008 2050479 ATGTGGTTTGGAGAGAGTGAAGCCAACGTTAGAGA AATATTTGACAAGGC[C/T]CGCCAATCTGCTCCG TGTGTCCTATTTTTTGATGAACTGGACTCGATCGC
solcap_snp_c1_5010 PGSC0003DMB000000008 2194132 TTACAGAAAGATGTTCCTTGGAGAGCTTCTTCTGG TGCAAAACCCATCCC[C/T]AAAATTCATTATTCC CCTGTTCTTCGTATACCTCAAAACCCTCTTTCCGA
solcap_snp_c1_5029 PGSC0003DMB000000008 2415674 ATTGAGGCCATCCTGATGGGTTCTTCGAGAAGTAA GTGATTTGAATGCAT[G/T]TTTGCTGAATTAATC AAAGACCCAGATGAAGAAAAGTGAAGAACTTCACA
solcap_snp_c1_5047 PGSC0003DMB000000008 2596540 ATTGTTGAAGCCCAACATGGTCACTCCCGGATCTG ATGCCCCTAAAGTTG[C/T]ACCAGAGGTGATTGC AGAGTACACTGTACGTGCCTTGCAGCGAACAATGC
solcap_snp_c1_5058 PGSC0003DMB000000003 42989 AAATTTGAAAAATCTACAAGAGCTTTGGCTTGGAC GCAATCGTATTCGAA[T/C]AGTTAATTTGTGCGG TTTGAAATGCATTAAAAAGATTAGCCTGCAGAGCA
solcap_snp_c1_5088 PGSC0003DMB000000141 988370 TTAGTTATGGCACTTAACAACCAAAAGAAAACTTT TGTTGTTGCCACTAT[G/T]GGTACCACTCCTATT CAAGCTACTCTCAATGCTAAGTTCCAGCACACTCC
solcap_snp_c1_5091 PGSC0003DMB000000141 989641 AAAGACAGCCGCTGCATATAAATATGGTAGTGTTT AGTGTTAATACTACA[A/G]CCATACCCCTGTTTT TTTGTAACATTTTGAATTATGATTGTGGGGTGATT
solcap_snp_c1_5099 PGSC0003DMB000000208 736057 ACGGTGCGTTCGTGGAACTATATTGGTCCGGTTAA CTGTTACAATGCCGG[T/G]TGGACATTTCTGGAC GATTTGTGGTGGTCCTCTAATCATCGGGCCCTATT
solcap_snp_c1_5100 PGSC0003DMB000000191 547127 CTTGAAATGACACAGCGAGAGTCACCAGCATTTGA AACAATGAGTTGGTT[C/T]TCTCTAAGGATTGCA ACACAAGCTGTGCATCCAGAAGTAGGTCCAGAAAA
solcap_snp_c1_5112 PGSC0003DMB000000251 757591 CCTTCAGCTATGACTATAACCATATGTCCGTTGTC TTTGAGCCTATGTTC[A/G]ATATACTCAAACAGT CCACCACTTCCTTCAAGATAGAAAGGGGATTCTGG
solcap_snp_c1_5113 PGSC0003DMB000000251 756844 TGAGTAGGTGGTTCTTCGTCCTTGTTTGCTTTAAT TATATCGACTCTCGT[T/C]CTCAAGAAGCTAGGT TGATTCGTCGAAGATAGAAGTCTTGCCCACATCCT
solcap_snp_c1_5114 PGSC0003DMB000000251 756779 ATGTATAATGTTCCAAAAGTTACTTAGCAAGGACT TGTTTCTCCATCAAA[T/C]TATCGTCTGATAATT GAGTAGGTGGTTCTTCGTCCTTGTTTGCTTTAATT
solcap_snp_c1_5115 PGSC0003DMB000000251 756758 GTTACAAGGGACCATAGATATATGTATAATGTTCC AAAAGTTACTTAGCA[A/G]GGACTTGTTTCTCCA TCAAATTATCGTCTGATAATTGAGTAGGTGGTTCT
solcap_snp_c1_5126 PGSC0003DMB000000251 628792 CTGTGTGGGGATCTTTTCTTCCTCATCACTTCCTG GATCATCAGGGTCAA[G/A]TACAGTCAATTTCTT ACCCTTTCCTCTACCTCGACCCATTGCCTTGAAAA
solcap_snp_c1_5137 PGSC0003DMB000000251 455564 CACACACCAACAGCAACAGTGGCTGCTTCAGCAAG CTCACAAGAGAAAGG[C/T]TTAAGGCTTGCCATG GTAGAATCAAAAGAAAATACTAGAGACGTTGCTGC
solcap_snp_c1_5145 PGSC0003DMB000000284 481912 GTTGTTACATGGCTCTTTGCCCCATTCCTGTTCAA TCCTTCTGGATTCGA[G/A]TGGCAAAAGATTGTT GATGACTGGGCAGACTGGAATAAATGGATAAACAA
solcap_snp_c1_5150 PGSC0003DMB000000284 710265 GGTTTTAGGACTAATTGAGAGTAACTGGGATTGGA TGAGGGCGGTAGGCG[C/T]TGGGTAGATGGGAAG TGAGAAGATTGGAGGGAAAAAGGGGGATGTGGTTG
solcap_snp_c1_5179 PGSC0003DMB000000048 819319 CACAGTGTTGCAATTGTTGCTTGGTGGTTATAAGG CTGTGGTGATTGATA[A/G]TTTGGATAATTCTTC TGAAATTGCTGTGAAAAGGGTCAAGGAAATTGCTG
solcap_snp_c1_5198 PGSC0003DMB000000116 1306873 CGAGCTTGTGAAAGAACATCTGTATGAATTTTATC AGTATTTTGTGATGC[G/A]TATGCTTCCAACGCC ATTGACAACCAAAAGAGGAAGCTAAGGGAAGAAAA
solcap_snp_c1_5206 PGSC0003DMB000000199 426798 CGGCTGTAACTCCAGATCTTGATCACCTCATGGTC CAAGAGGAAGCTAGC[C/T]TGAGTAGAAGACATT GAGGACGCTCAAACTTGTCACAAGCGCCATCACTT
solcap_snp_c1_5209 PGSC0003DMB000000018 100742 CTTGGTGGGCTTCAAGTAAGGTTGTTACCGATGGG TTTTCTGCCAAATTC[G/A]GAATCAAGCCATTTT TTAACAGAAATCTGCAGTTGCTGCTAGTCATCGTC
solcap_snp_c1_5217 PGSC0003DMB000000013 799018 CCGGTGAAACTTGATTCACAGGATTTACTTCAGAT CGGAGATAAGGAGTT[T/C]TATTTCCTTCTTCCA ATTCGCAGTATCTTAGGTGGACCAATTGGGCCTAG
solcap_snp_c1_5224 PGSC0003DMB000000235 481611 ATTTTTTTACCTTTTGTATCCACCAAATTATTGTC TTTCAAAGGAGTAAA[A/C]ACTGTTATTCCTGCA CATAATAATGGTGCTGCTCTGTCCATTGCCATGTT
solcap_snp_c1_5228 PGSC0003DMB000000235 964821 TACTGCCAAGACTGAGGGTAGCAGTGGCAATGATG CTGGTGGTGGAGAAA[C/T]ATCAGAAGCTATGGG GCATATAGGGACTGATCAACTGTTATTATATAGAG
solcap_snp_c1_5254 PGSC0003DMB000000092 900421 TAAAGTTGGAACTCTGTCCCCTAAGTGGGATCGTG GAGCAGGAAACTACA[A/G]TAACTCCATGTACAA GGGCGTGATACAGTCAGGTTCAGTTGGTTCATTAG
solcap_snp_c1_5267 PGSC0003DMB000000092 1188115 CGCTACCAAACTGTACCTATTTATGCCATTGAGGA TCTAAATGGCCGTCA[C/T]CGTATGCTCAAGTAC ACTCCTGAACACATGCATTGTTTGGCAATGTTTTG
solcap_snp_c1_5281 PGSC0003DMB000000092 1296474 CACTGAGGTGTATATCGTCCAGGTGTACTCATATT GCTTTCAGTATCGGC[C/T]GCTTTAGGAAGCATA AAATCTACTTGTGGCTTCTCTTTATCAGTTCCGGA
solcap_snp_c1_5286 PGSC0003DMB000000092 1332132 CTCAACTCATCAGATAGGGACACACCTTTAGAGAT CTCGTTTAACTCAGC[C/A]GCGGTGATCTTTTTC CGCAACGCCACCAGCTGCTCTCCAACATTACATAT
solcap_snp_c1_5287 PGSC0003DMB000000092 1332135 AACTCATCAGATAGGGACACACCTTTAGAGATCTC GTTTAACTCAGCCGC[G/A]GTGATCTTTTTCCGC AACGCCACCAGCTGCTCTCCAACATTACATATGTA
solcap_snp_c1_5295 PGSC0003DMB000000092 934079 TTCATCTTGCGGATCTTAGGGTTATGGATAATTGC TTGAAGGTAACAAAA[G/C]GTGTTGACCATGTCT TCAATCTCGCTGCTGATATGGGTGGCATGGGTTTC
solcap_snp_c1_5302 PGSC0003DMB000000092 1424433 GCCAGACCAATGCCGGTATTACCACCGGTTACCTC AAGGAGGACAGACTT[T/C]AGGCCATAATTTCCA CAGTTCAAAAAACAAGGAAATATCATTTCAGTTCA
solcap_snp_c1_5303 PGSC0003DMB000000092 1424458 GTAGCCACGAGCTGCAGCTATAAATGCCAGACCAA TGCCGGTATTACCAC[C/T]GGTTACCTCAAGGAG GACAGACTTTAGGCCATAATTTCCACAGTTCAAAA
solcap_snp_c1_5317 PGSC0003DMB000000092 1583348 GACTGGCAACCGTGGAACTCATGAATCGAGGCACC GAGCTAGTGACATTT[A/G]TTTTTAGTCCCTTCT CAGAGTTTCTTGGAGTTACTGTGATTTCAGGGACG
solcap_snp_c1_5340 PGSC0003DMB000000092 1626693 TAACCAGGGGAAAACAGAGGCCTTGGTCCATGAGT TGTTTCAGGGTAGTT[T/C]TCTTTCCTTTGAGGT ATCGAGTTTGAAGTTGGTGAGTATGGTTGTTGTGT
solcap_snp_c1_5346 PGSC0003DMB000000092 1644274 TCTGGCCTTGAGCATTGTCACAATCGTCATGTGCT TCATCGCGATATTAA[G/A]GGGTCAAATCTTCTT CTTGACAATTCTGGCATTCTCAGAATTGCTGATTT
solcap_snp_c1_5365 PGSC0003DMB000000039 2096513 TTGCAACATGATGACCATATTTCAGTTCCCCCTGT ATCCTACCTGATTCT[C/T]TCTCGGGATTTTTAG CTTGAATAAGTTCACAAAGTGTTAGCGATAACTTT
solcap_snp_c1_5374 PGSC0003DMB000000039 1784504 TTAGCAACAAAGAGTCCGCTTGTACAAGATGTCAA AGGATCAAATCGTAA[G/A]GTTTTTTGTATTCGA CCACTCTTGCATGGCCAATTTTTGGCAGCAGTAAT
solcap_snp_c1_5388 PGSC0003DMB000000039 1478764 CCACTTGGCCTAGGTGGGCTTGGTTCCCCAGGTTT GGAGCAAATGCTAGG[C/T]GGCATGCCTGATTCC ACTTCGCTAAATCAAATGATGCAGAACCCTGCCAT
solcap_snp_c1_5400 PGSC0003DMB000000039 1425030 GTTTTGTGAAGGGAGGTACTGTGTTTGGATAAGAT GGATTATGGTTTTGG[C/T]AGTGACGTTTGTGGC GTTGTTTGTGCCAAATTTTGCTGATTTCTTGTCAT
solcap_snp_c1_5410 PGSC0003DMB000000256 503426 TTCACTCTTTCTTTCCTCGAATCTAGGGCTTTTCT CTTTTCAACTTCGAT[C/T]TGTGAAGATCCCGTT GCGTGTTTTCTGTTGTTCAATCTGATCGGTCGATT
solcap_snp_c1_5411 PGSC0003DMB000000256 526740 ATGCGGTATACCAATTCTACAATACTAGTACAACA TACTCAATATTGAAA[C/A]GGGCTCACTGGGAAA AGCAAGAAGAAACCACCCCAAACAAGAATATATGG
solcap_snp_c1_5412 PGSC0003DMB000000256 526843 AAGGAAATTATCAATGGAATCATTGTTGGAACAAT TCAAACTCCAGCAAC[C/T]GAGACAAAAATGCGG GGAGGATGACATTTAATTAAAATATCTATCTACAA
solcap_snp_c1_5446 PGSC0003DMB000000302 565559 AACAATATTGTGAAGATGATAACCATAACAGATAC AATCATCAAGAAGAG[A/G]CCATAATAAGTTGAT GTTGAGAGAGACAAGAGCTACAACAGTTCATATAC
solcap_snp_c1_5452 PGSC0003DMB000000302 654462 ATGCATCAACAACAACTTGCTATGCTGGCGCAACA ACAGTCTTTACTGAT[G/T]GCTGCGGCTGCTGCA GGTGGTGCTGTAAGACTTCCTGTAAATGCACAACA
solcap_snp_c1_5458 PGSC0003DMB000000205 1099462 TTTCTGCAAACAGAGTAGCTGTTGTTGTTGCCAAT GACTGGAAAGATGCC[A/C]CTGACAAAGTAATGC CTGTAAAACAATGGCTTGAAGAAAGAAAATATTAC
solcap_snp_c1_5468 PGSC0003DMB000000205 775490 AGAAATATATGCCAATCCTCTCCTTGGGCAAGTAA CCTTGCTAAATGACT[C/T]ACTCTGTTCCACATA TATGCTACGTTGTAAAAGCAATTTCTCATATCCAC
solcap_snp_c1_5477 PGSC0003DMB000000059 1679072 GTTCTGATCCCCTTTCAGGAGTTGAGTCTAGCCTA GGCATCTCAAATGAA[A/G]AAGCACCATAAAATG GTTGAGCTCCATCAGTTGCGAACTGAGGATAACCA
solcap_snp_c1_5483 PGSC0003DMB000000048 2126094 ACATGTAACATATCTTAATCTAGCTAGCTAGATTA TTTGTCTAACGATGG[G/A]CAAAATCGGCTGATA TAACTCTCAAAAAGAAATTGAGAAATCATTTACAA
solcap_snp_c1_5499 PGSC0003DMB000000048 2045809 TGGACGATGTCAACTAGGTGAGCTGCACATATTTT CTGGTGCTTTATATA[C/T]GAGTGAGATGCCAGT TAAGTCTTGCTTCTTTGAAGGTTTAAGAATAAATA
solcap_snp_c1_5529 PGSC0003DMB000000048 1962642 GTATGGTGTGGATTTACTAAAGGGATGCAAACCTG TTAGCTGACACCGGG[T/C]TGCATCATAGGGAAG ATCCAGTTATTGCAGGGCTCCTTTCCAAGAACCTT
solcap_snp_c1_5546 PGSC0003DMB000000048 1861129 CAACGGAAATCAGAATTGAATCAGCTACTGATACT CTGGAACCAAACTAC[G/A]GAATTCTATATAGTG ACTAATTCTTTCTCCCTTGCTCGTCCTCATCATGA
solcap_snp_c1_5559 PGSC0003DMB000000048 1762475 TTCTTTATTCCGAGACTACAGAACTCACTGAGCAA CTCTTGAGCCGGACC[C/T]AAGTATTTCGAGTCC CTAACTTGATGATGATGATGAAAATACCCTTGTTG
solcap_snp_c1_5560 PGSC0003DMB000000048 1762469 TTATTCTTCTTTATTCCGAGACTACAGAACTCACT GAGCAACTCTTGAGC[C/T]GGACCCAAGTATTTC GAGTCCCTAACTTGATGATGATGATGAAAATACCC
solcap_snp_c1_5566 PGSC0003DMB000000048 1739400 AGCCAGTATACTCGTCATCGAGTTCCTCATCCAGC ATGCAAGTGGAAGAC[G/A]ACAGACCCTGCTGAT GTTGATCGCGTGCAGGTTTATAAGAAGTCTGACCC
solcap_snp_c1_5567 PGSC0003DMB000000048 1739391 CAAACAGTGAGCCAGTATACTCGTCATCGAGTTCC TCATCCAGCATGCAA[G/A]TGGAAGACGACAGAC CCTGCTGATGTTGATCGCGTGCAGGTTTATAAGAA
solcap_snp_c1_5578 PGSC0003DMB000000048 2199481 ATGCTAGCTGGAGTAGTTGTTGGAGAGTAGCGATC AACGACGTGTCCTTC[T/C]TTGTCAATGAGGAAT TTGGAGAAGTTCCACTTGATACCATCTCCAAAGAA
solcap_snp_c1_5580 PGSC0003DMB000000048 1716104 AGTTGCTCTTTCATTGCTTGAATCATGGTCAACAC GAGATAGCAACGATG[A/G]TTGATAGCTGATATG GTTAATGGCTTATGCCTTCTGCCAATAGAAGTAAG
solcap_snp_c1_5587 PGSC0003DMB000000048 1689308 ACAAGCATCTTTTCAAGCAAATCGACAGCCAAAGG AGACATGCTGGGAAA[T/C]CTTGCAGAAAATTGT TGCTTAGGATATTGAGGAAGCTGTCGGACATATCT
solcap_snp_c1_5598 PGSC0003DMB000000048 1642311 AGTACATTGAAAAGCAATGCTGGTTTGTTTTTCTG GATGGATTTAAGGAG[A/G]CTTCTTAAAGAAGCA ACATTTGATGGTGAGTTAGAATTATGGAGAATGAT
solcap_snp_c1_5598 PGSC0003DMB000000048 1640964 AGTACATTGAAAAGCAATGCTGGTTTGTTTTTCTG GATGGATTTAAGGAG[A/G]CTTCTTAAAGAAGCA ACATTTGATGGTGAGTTAGAATTATGGAGAATGAT
solcap_snp_c1_5600 PGSC0003DMB000000048 1640763 ATTGTTTACTCGTACAACGATACAGTAGTAAACAT TGCTAGAAAGATGTC[G/T]AGCTTTGGGCTAGTT TCAACTCAGACACAACATTTGCTTGCATCAATGTT
solcap_snp_c1_5600 PGSC0003DMB000000048 1644676 ATTGTTTACTCGTACAACGATACAGTAGTAAACAT TGCTAGAAAGATGTC[G/T]AGCTTTGGGCTAGTT TCAACTCAGACACAACATTTGCTTGCATCAATGTT
solcap_snp_c1_5601 PGSC0003DMB000000048 1640739 GGATTTCCAGGATTCAGAGTTGGGATTGTTTACTC GTACAACGATACAGT[A/T]GTAAACATTGCTAGA AAGATGTCGAGCTTTGGGCTAGTTTCAACTCAGAC
solcap_snp_c1_5601 PGSC0003DMB000000048 1644700 GGATTTCCAGGATTCAGAGTTGGGATTGTTTACTC GTACAACGATACAGT[A/T]GTAAACATTGCTAGA AAGATGTCGAGCTTTGGGCTAGTTTCAACTCAGAC
solcap_snp_c1_5602 PGSC0003DMB000000048 1639851 GCCAAGCAAAAAGCAAGCATTTCATGAGCACCAGT TGCTCCTCCACTCAT[A/T]ACTATTCTGTCTGGA TCAAATGTAACTTTGTCACCTCTCACTTTCTCCAT
solcap_snp_c1_5653 PGSC0003DMB000000010 673415 GGAAAAAGTGGCAAGATTGTTGGAAACGTCGATAC TAATCAACTCAAAAA[C/T]AACATGGCTACTATA TCTCCCAATGGACGTTTTATAGCTGCCGCAGCTTT
solcap_snp_c1_5656 PGSC0003DMB000000095 12382 TCAGGATTTAACTCTTCAATGGTAATTTGCTTCCG AGAGTCTTGCTGTAC[G/A]TCAAACGGGTCGTTC CAACCAAACCAACCACCAAATGGTTCAGTGAAAAA
solcap_snp_c1_5657 PGSC0003DMB000000095 15147 GGAGGGGCTTGGGTGGTTATGAACATCCAGCTCTG GAGTACTATGGAAAT[A/G]CAGGACCGGTGGTGC AAGTCAGTGAATCAGGGGAAGATTCTTCTAGGAGA
solcap_snp_c1_5680 PGSC0003DMB000000039 221324 CATTACAAAGGAGGCAATAAAAGAAGGAAATGGAA TTATATGTAGTTGCC[G/A]GAGAACGCCGGATGA CGGTTGCAAGACCTGCCTCATGAAGGAGGTTTGCA
solcap_snp_c1_5707 PGSC0003DMB000000483 162756 TGTACAGCTTTCCTTTCTGGTGAGCCTGCAACCAG GTTGCGTTCACAGGA[A/G]CTACAACAACTTATT GCTGCCCTTCTTGAATTTATGGCTGTGTGCAAACG
solcap_snp_c1_5710 PGSC0003DMB000000483 167459 AACGATCATTTTCTCTTGCCATCAATGTAGCTCCA TGAAGTTCAAAGACT[T/C]TGTTGAAGACAGGAA ATAGTGCTTTCCAGAAAGAGAGTGGTTGGTTTCGT
solcap_snp_c1_5713 PGSC0003DMB000000483 302307 TTAGAAACAACCACATCCTGGAAATATGTCCCCTG ACGGACTTCCCACCC[A/G]TTCAATGAATCTTCA GACTTGAATTTTGCAATTAAAAGCTTGCTTTTGCT
solcap_snp_c1_5714 PGSC0003DMB000000606 129183 CTGCTGTCAGGAATTCCTACCTATGCTCGATCGTA TGGCATCTCGCTCAA[C/A]GCTACACTTGCAGCA GACTACCCCTCCAACTTACACCATAAAGGTCATTC
solcap_snp_c1_5716 PGSC0003DMB000000009 844967 GATTGCCTCTGCTTCCATCATATTCAGAGGAGTTC AACGTGGATACAATG[T/C]GTTTCGGAGTGAACT ATGCCTCTGCTGCTGCTGGTATCCTTGATGTTACT
solcap_snp_c1_5723 PGSC0003DMB000000010 3505194 CTGTAATAAGGAAATATCTCAGGACATCCAAGAGA CCCAAATTTGCAAGG[T/C]AGCTCAAGTGATTCA GCCACCTTTTCCAATGCTAAACATCTGATATCACC
solcap_snp_c1_5732 PGSC0003DMB000000630 136474 CAGCTTCTCTCAAGTCGTATCTTAGACCAGGAAGT TGAAATTCTAAACCA[A/G]GTGTTCCTTACTTCT TAGATTACAAGGGAACAGAAGTGTATGCCAATACA
solcap_snp_c1_5739 PGSC0003DMB000000085 1843218 GCCGAAAACAATGTCATGTTTGAAGGTATCCTGTT GAAGCCTAGCATGGT[C/T]ACCCCCGGAGCAGAA TGCAAGGAGAGGGCCACCCCAGAACAAGTTGCTGA
solcap_snp_c1_5740 PGSC0003DMB000000085 1843170 ACCTTTGAGGTTGCTCAACAGGTGTGGGCTGAAGT TTTCTTCTACCTGGC[C/A]GAAAACAATGTCATG TTTGAAGGTATCCTGTTGAAGCCTAGCATGGTCAC
solcap_snp_c1_5750 PGSC0003DMB000000085 1757682 GGTTTGCAAGTTCTTCCTGGAGGGTTATACCAGCA ACGGACCGTCTTGAC[G/A]CAACTCCAGTGGCAT GCATGCAAGCCGACAACCACTTCATCAGGTTGTCA
solcap_snp_c1_5751 PGSC0003DMB000000085 1722758 AGTTGGAATCTGTTGGATTCTGTGGGGTGCAAAAC TTTCCAACTGTTGGT[C/T]TATTTGATGGTAACT TTAGACAAAATTTGGAAGAGACTGGAATGGGTTAT
solcap_snp_c1_5755 PGSC0003DMB000000085 1566635 TGTGGCTATCAGTAGCTTGGCCACGACGTGCCCTG ACATGAATGTAATCA[G/A]GTTTTTGAACCTCAG ACGTTTTCGAATTCTCCTTCGAATCATTTCCTGGG
solcap_snp_c1_5759 PGSC0003DMB000000095 657473 AAAAACATCACCTGCCTAACAAGGCTTGATCACAA CAGAGCTTTAGGTCA[G/A]GTTTCGGAGAAACTA AACGTTCACGTTGGTGATGTAAAGAATGTGACAAT
solcap_snp_c1_5766 PGSC0003DMB000000400 203670 CCTCAGCAGTCGAGGGAGCTGATAATATCTCCAAT AAGAAACGATTAGGG[C/T]TGGATATCCGACTCC CTTTTGGGGGCTGGTTGAGTCCTGCATGGAGTAAA
solcap_snp_c1_5774 PGSC0003DMB000000400 428333 ACGATAGGAAGAGCAGATAGTAGTTGGTTTAAAAT AGTGAGAGCAGAAAG[A/G]GGTTACCATTTGTTG AATTGTCCTGGTCCTTTTGTATGTCCAAATTGTGC
solcap_snp_c1_5783 PGSC0003DMB000000007 3637503 ATGATTTCATCCCCAGGATCAATGAATGAATCCTC AAAAGAAACCTTTGC[A/G]GGCCTATCAACTCCA AATACAACATCTCTCTTCTGTAACCGCTTAAAAGC
solcap_snp_c1_5784 PGSC0003DMB000000078 38839 GATTCGTCATTAAGTACAACATCAATTCCTCGCTG CCTAGCAACCGCAAC[A/G]ACGCCACTTTCATTG CCGAAGTCAAAACCAACCACACTCATCCTTGCTGA
solcap_snp_c1_5794 PGSC0003DMB000000695 14873 GCAATTCTAATACAAGTGTATCAGACCATATTCAA TAACAACCCAAGCTC[G/A]CTGATATTGATGCTT GCATTACTTCCTACTATAGTCACTCTGATGCTCAT
solcap_snp_c1_5796 PGSC0003DMB000000062 29835 GTTCTTGATAATATTTCAAAGCAAAAACCCCAGCT TTCTTCTTCAAACTT[G/A]TTCTGTAAAGGGTTC TTTTTCTTCAATGCAACCCCACGATCTCTACCTGT
solcap_snp_c1_5797 PGSC0003DMB000000062 29838 CTTGATAATATTTCAAAGCAAAAACCCCAGCTTTC TTCTTCAAACTTGTT[C/T]TGTAAAGGGTTCTTT TTCTTCAATGCAACCCCACGATCTCTACCTGTAAA
solcap_snp_c1_5799 PGSC0003DMB000000062 75329 AAGCTATTTGTTCCAAGAGTGGAGGATAGGAACAG AAACATGCGAATGCT[T/C]AACATTTCAAGCACT GAGGATTTGATTGCAAATTCAATGAACATTCTGGA
solcap_snp_c1_5812 PGSC0003DMB000000062 168457 CCAACTGAAGGTTCAGAAATTCTCTGTGGATCACC ATGAATTTCAGCTAA[G/T]GGGTTCACAATAAAC CCACGACTACTATGGAGTCGGTATGTCCTATTCTC
solcap_snp_c1_5820 PGSC0003DMB000000297 90947 CAGCCTCCGGAGAAAACAAAGCAGGATGTAATTTG TTGTCTGCAGCCAAC[A/T]CCAGTTTAAGCTCCA CATCTAGCTCTTCAATTGTCAAGGAACTTGGCCGT
solcap_snp_c1_5836 PGSC0003DMB000000216 764337 TTGGCCTTGCATCAACAGCCATAGCGTCTAGCTTC GGCAAGGCAATCTCA[G/A]AAAACAAAGAGCTCG AAGACTACAAACCAGAAGACATTGCCCGGTCCCTC
solcap_snp_c1_5837 PGSC0003DMB000000099 1462094 GCAGTTGTTCCTGAATTGCTAGGGGCAACAACTCA AAGAGCTCAAGGCAC[T/C]GAGGAGTAAGTTTCT TTTTCCAAACACCAGCTTCATCCACAACATCATGT
solcap_snp_c1_5845 PGSC0003DMB000000099 1583869 TTGGCGTCGTTGCTGTTATATCGCAAGATACTGGA CGAGATTGAAGCGAA[C/T]GACTACAACAACTTC ACAAGGAGGGCTTATGTGAGCAAGCCAAAGAAGCT
solcap_snp_c1_5846 PGSC0003DMB000000099 1583866 GTGTTGGCGTCGTTGCTGTTATATCGCAAGATACT GGACGAGATTGAAGC[G/A]AACGACTACAACAAC TTCACAAGGAGGGCTTATGTGAGCAAGCCAAAGAA
solcap_snp_c1_5871 PGSC0003DMB000000099 954669 AGCTTCTTTAATAGTCTCAATGTATCTGAAATTTC TCATACCAAAACTCC[T/G]GTCTGTCTCTTTCTC AGACAGCATCCTCCTTGTTGAGTCCAGCAACAAGG
solcap_snp_c1_5881 PGSC0003DMB000000099 1493276 CTTCTCTCTTTGGCCATCCTTATTGAGATCAGCAT GTGGTCTGGAAGGAC[C/A]ATTTGCAGGCTTCAA AATAACCTTTGGTAACTGAACTTTGGCTTGAGGAC
solcap_snp_c1_5895 PGSC0003DMB000000004 4438712 TAAATAATCTTGGACCCCCTCCTAACAGCATTGCA TGTTATGACAACCTT[C/T]GGTCTGCAATCTATG ATCCTTTGAGCAAGAGATTCAGCTGAGAAACCAGC
solcap_snp_c1_5908 PGSC0003DMB000000004 3868994 CTTGAAATTAACTCATTTGAGAAGGTTAATCCAGG CATTAACCCCCGTTT[T/C]TTCAACCAAAATATC GAACAGAAGCTTCCGCTGAAGAAAATCCCTTCAAC
solcap_snp_c1_5909 PGSC0003DMB000000004 3868898 TCAACACAAGCAAAAGCCACCAAGCGCTCCGCGAA GGTTTCGGAACCATC[G/A]ATCCAACGAAGGGCC CATTTCGCCTTCTTTTCAACACAAGGGATGGTCTC
solcap_snp_c1_5920 PGSC0003DMB000000004 3682653 TAGCTTGGACATTCCAATCCGTGTTCAGCCTCATC AGCAGATGCTACTGT[C/T]GCAAAACCTAGAAGT CCAGATACACCCGCTCCAATGAGTGCTAATGTTCT
solcap_snp_c1_5922 PGSC0003DMB000000004 3608657 GGAGTATTTGAGTTGTTAGGAACCGTTGGATCATC CTTATAGCCTTCATA[T/C]TGTCCAAGAACAACC TCTTCATCTTCAATTGGAAGCATTGATTGAAGAAC
solcap_snp_c1_5924 PGSC0003DMB000000004 3586291 GTTGACAGGACCAGGGTAACCACATCAAAATCTTG GCTCGGCCATGGTCA[C/T]GCTTACTGAGCAATG TTCTGATGATCAGTTCCCTCTGCTCTTCCCAGTCA
solcap_snp_c1_5931 PGSC0003DMB000000004 4371959 GCGAGGGTGCAATGGTTGACCTGCCTGACACCCTT GAACAATTCAGGATG[A/G]GCCTGACGGAGCTTT TGGTGGATGTTTGTCAGCTTTTAGGTTCTGCAGCA
solcap_snp_c1_5936 PGSC0003DMB000000153 701105 GCACCAGGACCACGCACTATTAGAGGTTGCTTCGC ATATCTTTCAGTTGT[A/G]AATGCAATTATGTTA TCTGATCCAGAGAGTTGTGCAAATGGATGCTCTTT
solcap_snp_c1_5940 PGSC0003DMB000000153 970918 ATCTCCGACGAAATGGACCCTTTGACCGATTAGAA ACCCGACCGAGTCTG[A/G]CCCTGATATGGATCC ACTTGAAATGGGTTTTTCAGTGTCCAAAGAACTCT
solcap_snp_c1_5951 PGSC0003DMB000000062 1958009 CAGCTTGGGATGGCAGCCAAGCACCATACTAAAGT ATACTGCAGACAGAC[G/A]CTTATAGGTGGAAAT TATGGGCTCCTTGATACCGATACGTTTGTTCCAAA
solcap_snp_c1_5955 PGSC0003DMB000000062 2145534 ATATGGTGGTTCATCGGGACCTTAAGCCTGAGAAT CTGCTTTTGGATGCA[A/C]GACGCAATGTAAAGA TAGCAGATTTTGGCTTGGGCAACATCATGCGAGAT
solcap_snp_c1_5956 PGSC0003DMB000000062 2145575 TTGGATGCAAGACGCAATGTAAAGATAGCAGATTT TGGCTTGGGCAACAT[C/T]ATGCGAGATGGCCAT TTTCTGAAGACTAGTTGTGGAAGTCCAAATTATGC
solcap_snp_c1_5959 PGSC0003DMB000000497 179659 ACGTACCCTGCTGCATCCCCAACTAATGCGACTCT GTCTTGCAATCTTCT[A/C]GGCCTTGGGTGTTCT GGAATTGGGTGAGCCTCAACTCGGATGATTTTCCC
solcap_snp_c1_5964 PGSC0003DMB000000399 181120 TTCGTGGATAAACTAGCATGGATATGTGGTAGATG CCCTCCTCCTGAAGC[T/C]CTACTTGTTGGATCT CCTAGGGTTTCCAGGTCTCAACTCAATGCCATACT
solcap_snp_c1_5965 PGSC0003DMB000000399 408716 ACATAATAATAGCAAAAGGAGGTTCAAGTCACTTA GTTAGGACAAAGCCA[G/A]CAGCCCAAAAGCAGA AATAGCGTATTTACTCACACAAGATTGTTCATACG
solcap_snp_c1_5968 PGSC0003DMB000000076 1916168 TTCTCTGGGTTAAGAATCCAATCACAATACTCCTT GTTGGACTTCCCAAG[A/G]AAGGCATCAGAATAT TTTTCTGGATCACTGGCAACTGTTCCAGCTATAAC
solcap_snp_c1_5981 PGSC0003DMB000000076 1630702 GAAGATAAGCAGTGAGATTGCAGGGGATAGCGAGC AAGTTGAGAGTCTAA[C/T]AGTGGACGAATCTGA CTTATCTGTAAAAAAGTTGGATGAGTTTCATGTGC
solcap_snp_c1_5988 PGSC0003DMB000000076 1588503 TGTGAGAGCAACTCCTGCATCTGCTCTACACAACC ATATTGTCGACAATA[G/T]GGGTATATTGATGGC AAAAATTGAATCATTTGTGTCGTCTTACAGGAAGT
solcap_snp_c1_5994 PGSC0003DMB000000076 1552335 CCATTCATAGATCTTGCTGGTGATGCATCAGATGC AACAGTACTTGCAGG[A/G]GACTCTATATCGTCC GCTGTCTGCTGAAGGCTCCAGTACATGATGCTGGC
solcap_snp_c1_5995 PGSC0003DMB000000076 1551066 CTTCAGCTTTTGAAGAACTTGAGATCGCGTTTCCG AGGGAAGGAGATTAC[T/G]GATGCTGATATTCTC GCTTGGGCAAACAAAAAAGTCAAAAACACTGGAAG
solcap_snp_c1_5996 PGSC0003DMB000000076 1551042 TGGCAGTTGATGAGGTTTAATATGCTTCAGCTTTT GAAGAACTTGAGATC[G/A]CGTTTCCGAGGGAAG GAGATTACTGATGCTGATATTCTCGCTTGGGCAAA
solcap_snp_c1_6004 PGSC0003DMB000000297 768724 GGTAGCCGCCGTGAGTTCAAACGGAAAACCTGGAG ATGGAAGTGTTAGTG[T/C]ATTGGTGGAGAATGC TTTGACGGAAAGTGCTGCACCGGTTGAGATGGAGG
solcap_snp_c1_6006 PGSC0003DMB000000877 17091 CTATCCAAGAAAATAAGCTTAACGCCATTGCAAGT TAGCAGCTGCTCTTT[T/C]CCAAGTAAAGCTACA TTTAGCTTAGAACTAGTGGCAAATTTGCACATCCA
solcap_snp_c1_6033 PGSC0003DMB000000185 637798 ACCGTCATATAATAATGAAGCCCAACAGCAAAGCC CACAAAATTTTGGGT[C/T]AGCCCAATCATTTTC GTAACCGGCCCAGTATCCGTTGAGAATACTAAGAC
solcap_snp_c1_6036 PGSC0003DMB000000185 815549 TTATTGATTCGAATACCATACCCGTTTGCATTGTA GAGAGTCAAGCTGAT[G/T]ATTGAATCGGTTCCA GCTTTTATTTTTGAACTGGTTCGAACGTAAACTGT
solcap_snp_c1_6037 PGSC0003DMB000000185 1075240 CATTTACCCCAATGGCGTTGTCTAACTCCACGATA AAGCTTAGTAGCCTT[C/T]TGTGAAGAAGCACCA CCAGTTTGCTTCATCGGGACTGGTTTCATACCAAG
solcap_snp_c1_6040 PGSC0003DMB000000185 1114696 ACTGCAAAAAGAAAAAGAAACACTCGTAAATCAGA CCTCTTCAGTCGAAG[A/G]AACGAAACCCAAGTG AAGCTGAAGAAAAGCTCTAAAACAGAGGAGAGAGT
solcap_snp_c1_6046 PGSC0003DMB000000201 786478 AGGCTTTTTTCAGCATATAGAGACAATCTTGCAAA GAGTCAACGAATCGA[C/T]GAACGATGGAAGCAA AAAACTAGAGGAGGTTCCTTACTAGATCTATGCAT
solcap_snp_c1_6048 PGSC0003DMB000000201 1058676 GAAGAATCATCATCAAGTAGGAGAGCTGGTGGCTT CCCTGGTGGCATGCC[C/T]GGAGGCTTTCCTGGT GGCATGCCTGGTTTTCCTGGTGGCATGCCCGGAGG
solcap_snp_c1_6052 PGSC0003DMB000000201 501999 CCACATTCTTGCATTTTCTGCATAAGCTCTACAAT TTTGTTGAAGTTGCT[G/A]GGTTCGGTTTCATAA ACTTTGTTCAGATCTCTTATAAATTCATACTGTTT
solcap_snp_c1_6068 PGSC0003DMB000000027 664515 GCCTGCACGGACCACATCTACTGGATCATTCAAAC ATGCCAGAATATTAA[C/T]TGACATGTCACTTTG AAGAGATTGTACAAAATCAACCCGAGTCTCCATCC
solcap_snp_c1_6077 PGSC0003DMB000000098 1651122 CCCATCATTAATGGTGCACATTCAGCCATTTCACT GAAAACAAAGAACGT[G/T]TTTATAGAATGTACA GCCACAGATTTGACGAAGGCCAACATTGTTCTGAA
solcap_snp_c1_6083 PGSC0003DMB000000098 1616720 TCTTGAAGGGCATTAGATGCGATTTCGAGTCGAGT AGTTGCAGTACGGAT[A/G]TTGTTGAGGCTATCT TGAAGGAGGTTCACTTCTAGATCGGCTTGTTCTTT
solcap_snp_c1_6087 PGSC0003DMB000000098 1586262 CTCTACATGTCGACGTCGGTAGAACCAAACGGCGC CGTTTTACTCGATTC[T/A]ACCGCCGGCTCCGGT GGTGGAGTTGCTAATAGTAATGGTGCTTTGACGGT
solcap_snp_c1_6108 PGSC0003DMB000000098 1380371 AAGAAACCATCTCTCTCTTCCTTCATTATTGGAAT GGGATCAAACTTCCG[T/G]GAAAGAGAACTATCA CCACTACACTTGTTAGATGCTAATTCTATCCAGAA
solcap_snp_c1_6109 PGSC0003DMB000000098 1380365 CCATCTCTCTCTTCCTTCATTATTGGAATGGGATC AAACTTCCGTGAAAG[A/G]GAACTATCACCACTA CACTTGTTAGATGCTAATTCTATCCAGAAACAAGT
solcap_snp_c1_6114 PGSC0003DMB000000098 1357051 AAGGTGTTGGTTGATGAAGGTTCAAGGCAAGTAGT GGAATTAGACCAAGC[C/A]GCAATATGGAGATTT CTTTGGTGGTCAGGAACAATATCTGTTCATGTATT
solcap_snp_c1_6123 PGSC0003DMB000000098 959811 CTTTATATGGATGCAAAGTATTCTTTGCTGCCTTT AGGATCTGGCTTCAT[C/T]GACTTGTCACCAGGC TTCCACCCGGCTGGGCATACCTCATCTGGGTTCTC
solcap_snp_c1_6126 PGSC0003DMB000000006 857510 TCTGTAGAGTGGACTCTGCTGTAGTTAGATATGCA GACTAAGAAAAAATT[G/A]AATGGGAGAAATCCA CGAGAGCTGGCTAGTCCAAAGGTTTCAAGGCAGCA
solcap_snp_c1_6127 PGSC0003DMB000000006 855939 GTGCATCTCTCTATCAAAGATTCAAAACTGGAATG CATTGATGAATTTAA[T/C]CAAGTTCAGTTGCCT GCTGATGTTAATATGGAGGAAGAGGAAACTGAAGA
solcap_snp_c1_6130 PGSC0003DMB000000518 241206 ACTCGATTTCCCAATGATATGCTGATTATGACGAT TGTCCTATGCTATTC[T/C]GTCATAGCTCCAATA ATTATTCCGTTTGGTGTGGCATACTTCGGTCTAGG
solcap_snp_c1_6131 PGSC0003DMB000000518 241139 GAAGTATTTGTGCAAAACTGAAGCTGAGATAAAGG AGGCTTGGGCTCCTG[A/G]CGATCTAGGCTATGC AACTCGATTTCCCAATGATATGCTGATTATGACGA
solcap_snp_c1_6136 PGSC0003DMB000000518 184712 GGAACAATTGGGAGACCATTGTTTTCGCCTTCGGG ATTGCAAGAACTTGT[G/A]TCATTGTACTGTAAT CCATGTAAAAGCTGTTTATCACTTCTGCTTTTGAC
solcap_snp_c1_6138 PGSC0003DMB000000518 183718 ATAATTAAGTCACCTTCCTCTAAGTCCACTTCAAT TCTTCCATATAACTT[A/G]CGAAAGGTAGGGAGA GCAGCAGTACGCATCCATACAATGAGATCCTCCTG
solcap_snp_c1_6140 PGSC0003DMB000000518 183595 CCGACAGCGACATAGGACATCCCAAGGAAGTTATT CCTGCCTCCCAGCCA[G/A]CTGGTTGTTGAAAGA ACAAGTTTCTTCCTTCCACCAAAACTGTACGTGTT
solcap_snp_c1_6142 PGSC0003DMB000000518 120784 GTAATTGTTGGATGGGACGCGATGAAAATAACCAT CGGCATCTACTGAAG[C/T]GGTTTCTGGAAATCT GAGATAAACCCTTTGAAAATATCATCGTTCGTTTT
solcap_snp_c1_6148 PGSC0003DMB000000119 485463 ATAAACCCACTCATATGGACAAAAACACAACCAGG AATTCCTGTTTCCTT[G/A]GATAGTTCATCGTCT CTTAAACCTCGCCACTGAGATGGAAGTGCTTTCCT
solcap_snp_c1_6157 PGSC0003DMB000000013 2139147 TCAAGTGGTACTCCAGTTGCTCGCCCACTTTGGAT GGAGTTCCCTGGAGA[C/T]GAAAAATCTTTTAGC AATGATGAGGCTTTCATGGTTGGGAATGGTCTTCT
solcap_snp_c1_6159 PGSC0003DMB000000049 2255882 AGATTTTAAGCAAAACAATGACATGGGCCTGACCA GATTATGCCATACAA[A/C]CAGCAAGCATTTTGA GCAGAACTAATTTCGAGAGACTCGTGTTCAAACTA
solcap_snp_c1_6166 PGSC0003DMB000000110 594197 CAGGTAATGTGATGATCAGCAAGAGCATCAAAGAT CATTGAGCAACCAAT[A/C]CTGCGGACTCAGCAA AGAACTGCCATTATACCGAATACTGCAATAGTTTC
solcap_snp_c1_6176 PGSC0003DMB000000110 630510 AGACCAGAACCACCACCATTAACCAAAGAGCAAAG GCATTGAGGATTGGA[T/C]TGGACAACACTAGAC AGGGATGTACAGCAAGTTGAAGATGGAGTGGATGA
solcap_snp_c1_6183 PGSC0003DMB000000110 849027 TGTGCAAGGATTGAATAGGAGCAATGTCCATCCGT ATGATTTCTGCTCCA[A/C]AGGCAGCTTTCTCTA CCAACTGTTGTTCTACTTATACTAGTATTAGGAGT
solcap_snp_c1_6188 PGSC0003DMB000000184 66243 TAGATTCCTAGGGCATATGTGATGATGTAGAAACC TTGAACCATGATCAC[G/A]CGAATAGCAAAGATG AAAGCGATCGTAGCGAAGAAGATCCACCGATAAAG
solcap_snp_c1_6192 PGSC0003DMB000000110 428689 AAAAACTACCTTGAATTTTTCATTGTAAAGATCAC TCAGGAACTGGAATG[G/A]TCCCTGTTAATTTTG TTAGGAATTTCTGTTTTACTGGAAATTACTCCCAA
solcap_snp_c1_6193 PGSC0003DMB000000110 428691 AAACTACCTTGAATTTTTCATTGTAAAGATCACTC AGGAACTGGAATGGT[C/A]CCTGTTAATTTTGTT AGGAATTTCTGTTTTACTGGAAATTACTCCCAAAA
solcap_snp_c1_6196 PGSC0003DMB000000110 430549 TTTTGGGAAAATTATCGGAGCAACAGAAACCCTAG GCCGATGGATATACT[A/G]AAACAGGAATTGGAG CTACGTCGGAAAAATCTGGCCCAAGACGTCGGTGG
solcap_snp_c1_6207 PGSC0003DMB000000132 763183 TCTGTGCTTTGTTTTCCAGTCAGCTTCTCCTTTAT GGCTTCCCAAAATGT[C/T]GGTATTGCAACCTCA TCAGGAACTTCCTTAAACGATGGGAGGTAATTTAC
solcap_snp_c1_6228 PGSC0003DMB000000760 52798 TTTGCAGGAAACTTGGCATCTGGTGGTGCAGCTGG TGCCTCATCTCTTTT[G/T]TTTGTGTATTCTTTG GATTATGCAAGAACACGCCTTGCTAATGATAATAA
solcap_snp_c1_6238 PGSC0003DMB000000760 36505 TTGATCTTTTTAAGAAAGAATTCTGGGGTTTGGCT TAGAATTCTGTTTTA[T/C]TTATGGTTTTTCTTT GGAGGGTTTTGCCAAGTAAAGGGACTCAGACCTCT
solcap_snp_c1_6240 PGSC0003DMB000000233 496831 CCATCCCTCCATCCTTATCAGGATCCACCACATCC AATTTTTTATTAACA[C/T]TGCAGCAATTTGCAG TAGAACCATTGTGCTTTGAGTCAAATGATTGCAAA
solcap_snp_c1_6244 PGSC0003DMB000000233 637974 GTAGTGACAGCGATGAAGACGAGAGTAGTTCAAAT GATGAAGCAGAAGAG[A/G]AGGTGGATATGGAAG AAGGCGAGATTGTAGCATCTGATGTCGATGAGATG
solcap_snp_c1_6252 PGSC0003DMB000000070 389955 CTTGAAAATATTTTGAAGGTTGGGGAAGCTGAGAA GAATTTGGGCCGGAC[A/G]TCAGATATAAATCTT TATGCTCAGCTGATTGATGATGCTGAAGGTTTAGA
solcap_snp_c1_6262 PGSC0003DMB000000070 508974 TCAGCAAGATATTCACATTTAGCAGCCGATAATCC AGCCAAGGATATCCT[C/T]CCATCTTTTGTCATG TACACATGCCACTTATCGGCCATGTTCTCGCTCTG
solcap_snp_c1_6294 PGSC0003DMB000000010 3316227 GCAGGCTCATTTGTTGCAAGACCAGATGAACTGGC AATGGTTGGCACTGT[C/T]GGTCCTCCTTTACCA ATTATAGATGTGTGTCTAGAGTCTGTTCCTGAAAT
solcap_snp_c1_6298 PGSC0003DMB000000473 287323 CAGTCTGTGGAGCCCGATCTAAGTGTAACTGTTAA CGGGTTGAAAATGCC[T/G]AACCCATTTGTTATT GGGTCGGGTCCACCAGGGACCAACTATACAGTGAT
solcap_snp_c1_6308 PGSC0003DMB000000489 79326 TCAGACGCCGCTCTTATTCTCTCCTCCTCTTCTTC AACCTCACTCTTATG[T/C]TCACCATCCTCGTCA CTTAGATCCAGTGATGATATCTCGTTTTCTACGCA
solcap_snp_c1_6318 PGSC0003DMB000000489 189776 ATGGAATGGTGATCATTTTTGGACCGGTGTAGATC GGATCTGAAGAAGCA[G/A]AATCCGAGATCTCTG ATCAGAGAAGAGAGAGAAAGAGAGGGGAGAGAGAG
solcap_snp_c1_6332 PGSC0003DMB000000159 1267282 CTAACGACAGTTGCGGAGCAAAGTGAGTGAGGTGC GAGGGAGAGAATCTG[T/C]TTAGCTTAGAATCAA CGAGAAAGGAGATGGCGAACGAGGAGGCGGAGAAG
solcap_snp_c1_6334 PGSC0003DMB000000159 1198850 TGCCTCAGCCAAAAATATGCTTCACGGTAGTCATC GAAGATAACCCTATT[C/T]CCATGGGCACCCCTT GCAGCTAGGACAATGGAGGGAGATGAGTATGCCTC
solcap_snp_c1_6346 PGSC0003DMB000000081 959092 ATCAAGGTCATTATTGTTAGAGTGACCTGCAGTCT GCTACAATTTCAATG[T/C]TGACTTCATGTATCT CAAAGCAGATCGTAGCATCGCTCTAGCTTTCCTAT
solcap_snp_c1_6348 PGSC0003DMB000000400 76573 ATAGGCCTCTGAACTACAACAGGTTCCGTTGTATA CTCTAGAGATGTCCA[G/C]TGTAACGGCTCAGCT TTCGCAAGGCGAATCTCAATTTTGGTAGACATCAC
solcap_snp_c1_6349 PGSC0003DMB000000657 20184 TTCTTCTTCTTCAATGGAACGGATCATGTCACTTC CACATTCCTCCATGA[C/A]CATGAGGTTACGCCA TTCCAATGTCCCTTCTTTGCTTCGTCTTTCTCCTC
solcap_snp_c1_6352 PGSC0003DMB000000126 1271493 TTGTAAAGGAGTATTGGTCTCACTATGACTCGGCT GAATCTCATTGAAGC[C/T]AACTGTGGATTTGCA ACATCTTTTTTGGCCAAACACACATTGCCCTGTGT
solcap_snp_c1_6355 PGSC0003DMB000000126 1270801 AGGATTTTGGTAGATGGAATTGACATTTCTAAAAT TGGTCTTCATGATTT[A/G]AGGTCCCGTTTTGGG ATTATACCTCAAGACCCTACACTCTTCAATGGAAC
solcap_snp_c1_6358 PGSC0003DMB000000126 1270007 AGTTGATGCGGATAAATGGTACTACCAAATCATTT GTGGCTAACCATCTT[T/G]CTGAATCTATTGCTG GAGCTGTCACTATAAGGGCATTCAAAGAGGAAGAT
solcap_snp_c1_6358 PGSC0003DMB000000657 14119 AGTTGATGCGGATAAATGGTACTACCAAATCATTT GTGGCTAACCATCTT[T/G]CTGAATCTATTGCTG GAGCTGTCACTATAAGGGCATTCAAAGAGGAAGAT
solcap_snp_c1_6385 PGSC0003DMB000000126 1116121 AGGAAAGCCCAATCGGACATCCGAGGAGGGGCTGG TACCCTGAGGTGGAG[G/A]CTGCTGAGGATGTAA GGGTTCTACCCCATCAGTGATAACTATTGATTGAG
solcap_snp_c1_6390 PGSC0003DMB000000126 1109204 GGTCAAAACTGCTCCTTTGCGTGCTACCATATCCA CATTAGAGCTCCAGC[G/A]TCAGAATCATGGCCC GAATCAGTTATGTCAGCGACCATTGCCCGATCCAA
solcap_snp_c1_6398 PGSC0003DMB000000126 1020619 CTTACATGCCAGCTGCTAGTATGCCTTCTCAAATG GGTCCTGGGATGATG[T/C]CAATGCATGGACAGA ACGTCATGCCACATTCTACTTCAATGCCTCCTTAT
solcap_snp_c1_6405 PGSC0003DMB000000126 1001904 AATCTGTTGTTCGAGTACAAAAAGAGCAGAGATGG TAAAGTCTACGACTC[G/A]TTCAGGATATCTCGA GATTATAGAGACATACTGGCCTGCACAGTTGACAG
solcap_snp_c1_6411 PGSC0003DMB000000126 962105 TTCTGATCACCCATTTGCTTTGAGCAAGGTACAAA ATGAGGGCCTCCAAA[A/G]TAACCATCTCAATCA AACTCCACGTAATAGGCCTGCTCCATGAATAGAAG
solcap_snp_c1_6425 PGSC0003DMB000000126 901561 AAAGATCCCTTCACATTGCTAACCTGGTGGACATC CATAAAATTGTTTGC[C/A]TATCATTTGTATGGG AAGCTTAACTATGCTCAGTCAGTGGATGAACATAC
solcap_snp_c1_6462 PGSC0003DMB000000082 1184129 CAACAGCATTTTTTGGAGGAGGAGCTATGACTTTT AGTGGTTCTAATGGC[T/G]TCCCTTTCCTCACAT TCCTACGCCAAAACATGATAACTGCAAGCACAACC
solcap_snp_c1_6465 PGSC0003DMB000000082 18474 TTCCTCACAATCTTAAGGACCAACCGCTTCAATAA CTGCATTCCTTGAGG[T/C]ACATAGCAAAAAATT GTGCTCTTCTTCAAATTCTCTTTGCATTGAGTTGA
solcap_snp_c1_6476 PGSC0003DMB000000229 231873 AATTTGAAGTATTAAAAATGTGTCATTATCGGTTT TATCCAATACTCTAG[G/A]AGAAACACGGTACAG TTTACCATGAAAATTTGCAAATCTGTTACCGTGCA
solcap_snp_c1_6485 PGSC0003DMB000000284 249809 TTCCATCGGAGCCGAAGCTCGCCGGAAAAGGAGCG TACAGCAACGAGATG[A/G]TGTATTCGCCGGCGG ACGTGCAGAAGATCGTGCAATATGGAATGGAACAC
solcap_snp_c1_6501 PGSC0003DMB000000173 23580 GCATTTTGAATTTTCTTACTTCAAAACAAGAACTT TATCAATTCCAGTAG[C/T]TTCATGTCTGATGTA TGCCTCATTTTATCGTTACTGCTTTCTGGTTTTTG
solcap_snp_c1_6518 PGSC0003DMB000000173 169619 GCAAGCAATGGAGAGAAAGACAGATGCGGAAGATA ACAGACAAGGTGTTT[G/A]ATCGTTTCAAAGATG AAACAGGAAAAGCTTATCTCAAGTTTGAAGACCTT
solcap_snp_c1_6521 PGSC0003DMB000000173 299517 TGGCAGGCAATCTGGATGAAGGTCCAATACAACAC TATATCTCAATGGCC[T/G]GATATGCATAAAAGC TGGGTAAGCTTTTCGAAACTTAACTATTTCCTGAA
solcap_snp_c1_6523 PGSC0003DMB000000022 265503 TACTCAAAACTCGTTGACGCCCATGCTAGAGATAA CCGGCGAGAAGATGC[C/T]GAGAGAATTATCAGA AAGATGAGTGAAAATGGAATTGTACCTGATATTCT
solcap_snp_c1_6546 PGSC0003DMB000000174 304252 GTTTTATTCGTCTCCAAGACCGTCAAATCCACTAA CGCCCGTTAGTAATG[C/T]TAATCTTACGACGTC GTTCGCTAAACCCGACCCGAAGAAGAAGGGTCAAA
solcap_snp_c1_6556 PGSC0003DMB000000174 358303 AGGGGTTTTGAACATGGAGATTCTTTTATCATCGC CCCATTCTTGTATAA[T/C]GGAGTCAGGGGTCTT AATGCAAGCTGACCAGTTAACAGCAGAGCCACCAC
solcap_snp_c1_6571 PGSC0003DMB000000174 454138 TACAACCTGGATTTGAATCCAAGTCTTCATCTTTT ACCCGTGCTACTGCA[A/G]CAAGAGGGGGTAGGG ATGATGCTCTTAGGAGCTTTGAGCTACTAACTATT
solcap_snp_c1_6585 PGSC0003DMB000000174 506377 ATGCTGAAATTTCCGAACAATAACTTGAACAATGG AGGAAGGATACGCAC[G/A]GTTTTTGACGTTGGT TGTGGTGTGGCTAGCTTTGGTGGTTATCTTCTATC
solcap_snp_c1_6632 PGSC0003DMB000000354 335687 ATCACTGAAGTGTTTTGCAGGCGATAGCAACACTT TGGTGGATTTTGGAT[G/T]TTATGCTGCAGATAC ATTCACTAATTCAGATGGACACAGTAATCCGAGTA
solcap_snp_c1_6635 PGSC0003DMB000000354 353350 GACTAGCCAAGGCGCATAATGTGCAACTCGAAGTG CCCATTGGTCCTGTG[T/G]GAGCTGTAGATTGTA TCCTTCTGTGGATAAATTAGCAGGAAAGCTAGGCC
solcap_snp_c1_6643 PGSC0003DMB000000354 587928 ACACTAATAGGTACCATACCATAGTATTAAGTCAC CAAAACAAAGCGTCC[A/G]CAGCATTGTCTCACA TTTACAAGAAAGGTTTTGTACACTACAGAAATGAG
solcap_snp_c1_6646 PGSC0003DMB000000745 75910 CCTCTAACAGGTCCCTTCTGAATACGCTTCATAAG GTGGGTGGAGAACCC[A/G]GCAATCTTGTTGCGC AGACGCTTTGAAGGAATAATGGCAACTTCCTCCAA
solcap_snp_c1_6651 PGSC0003DMB000000098 269219 TTGACTCGCCTACACAACTCAACTCAACTCAACTC AACTTAACTCGACTA[C/T]ATTAATGGAGATGAT CATAGATGGAGAGCACGACCCGATTGTGTTCTTTG
solcap_snp_c1_6668 PGSC0003DMB000000098 417536 CATATCTGTCGTGCCAGGGAATTCCTTTGTCGGTT TTTTCCACCCTGATG[G/A]GATGGATGAGGGAGG ATTTGATTTCTTGCATGGTGCCATGTCATTCGACA
solcap_snp_c1_6674 PGSC0003DMB000000098 486063 ATAGATCAAATGTGCCGGGTGAGAATACACAAATT TCCATAGGAGTTTCC[A/C]TGGAAGATAACGGCT CGAGTGTAAAATGAGTAGAACTAGAACCTGACCAA
solcap_snp_c1_6704 PGSC0003DMB000000098 621028 GAAGATAGTTTGGGAGGGAAGATTGAAGGTTCAAG GCTTAAATTTGTTGA[C/T]AATCAGCTAAGACAG CAAAGGGCTTTGCAACAATTGGGAATGATCCAGCA
solcap_snp_c1_6711 PGSC0003DMB000000223 953978 ATACTTTTCATGGATAAAATAATACGTTAAGTTAT GTGAACTCAGAATTT[C/T]CAAGAGGAACTTAAA ATGTACTAGATTCCTTTAGCTTATCTACCCATGGG
solcap_snp_c1_6748 PGSC0003DMB000000002 463647 ACATCCTTGTCAAATATCGGATTTAGACTGTTCAA CTCGTCAAGGCTAAG[G/A]TCTTGAAGCTCGCAG TTTCTGGAAACACACAAAGCGACAGACCTCCCAAC
solcap_snp_c1_6749 PGSC0003DMB000000002 487561 CGGAATGGAAATAGCTCGACCAACTCAAACAAAGA TAAGACGGACGATAA[A/G]ATGCCAGGAGCTCCA AGCACACAAAGTACATCAAATGACCAGAAAGAACG
solcap_snp_c1_6758 PGSC0003DMB000000002 592778 GCCCGAAGCAATAGGGGCTGAATTGGGCTTTTGGG CTACTAAACTGGACA[A/G]GTAAGAAAGTCTTTG TGGATCTTTAGAGGCCATGTTGATAACAGTGTTTT
solcap_snp_c1_6787 PGSC0003DMB000000001 5893739 ACAATGTATATCAAGGCCCAACTGGGAAGCTGAAG TTATCAATTGTGCAA[G/T]CTGATCAGTTACCTT AAAAGGCCCACTTTGATAGTGAGCTCCAGAGTGCA
solcap_snp_c1_6795 PGSC0003DMB000000001 5892191 GGAGTTCATCTAGCAGTGCTTTCAGCATTCATCTG TCAAAGGCATCCAAC[A/G]GCCAGCTTGAGTGCA CTTTTTTTTATTTTCTTCAAAACATTTGCCTTTTG
solcap_snp_c1_6808 PGSC0003DMB000000067 340027 GACTGTTCCAATAGCGAGCTGCGCGTTGATAAAAA TATATCTGGTCCAAA[G/A]AGAGCTGGATTATTT ACAGAAACATTCTCAAGAGGCTTCTCTATTGTTTA
solcap_snp_c1_6815 PGSC0003DMB000000067 825083 TGATTAGGAATGAGAACCAGCAACTTAACAGAATC CCCTGGTTGAACCAC[A/G]TGAGTTAATGCCCAA ATAAAAGCACTTCTTGAAATCTCTCTCGAAGCTTT
solcap_snp_c1_6816 PGSC0003DMB000000429 130829 TTCAATGGCTTTGTGGGAGAGTTGAAGAAATAATG GGTCCTTCTCCTCAC[C/T]CCGTTGTGTCATAAA AGAAGCACAAATACGTTTACCCAATTCCAAATCTA
solcap_snp_c1_6825 PGSC0003DMB000000429 229116 CCATCTGAATTCAAAAATGAAGCATATTTAACACC TGTCGAACCCTTAAT[C/T]TGTACATTTTGATCA TTACAATCCGCATTTTCCACAACCGCCACCTCCTC
solcap_snp_c1_6841 PGSC0003DMB000000574 234424 AAGCCCTTGGTTTGCAAGGAGCTGAGCAAGGTGTG GGACAGATATGATCC[C/A]AATCTACCATGGGAA AGAGGGGATTATGATGAATCAAATACTTTACTAGT
solcap_snp_c1_6851 PGSC0003DMB000000154 1213954 ACGAGTCCGACCTAGACCTACTGAAGCTGGAAATA GAGAAACTCGCATGA[T/G]TAGACATCTACTACA AATGCACAATGCGAGAAAAAAGGACAGCCTAGTGA
solcap_snp_c1_6853 PGSC0003DMB000000154 1116403 CTGGTCGTGGTCGAGATCGGCCAAGTCCTGACTAT GGTCGTGGTCGAGAT[A/C]GGCCTATTCCTGACT TTGGTCGTGGTAGAGATCGGCCAAGTGCTGACTTT
solcap_snp_c1_6864 PGSC0003DMB000000154 981867 ATATGTTATGCTGCATACAAAAGCGGAGATATGTT GACCACTTTGCCTTG[T/C]GCACACATGTTTCAT TCAGAATGTATTAACCGCTGGCTAAAAGAAAGAAA
solcap_snp_c1_6869 PGSC0003DMB000000154 1278825 ATTGAAATAATGACCAGGCTTTCTGGCCACCCAAA TGTTGTAGATCTCAA[G/A]GCGGTTTATGAGGAA GAAGATTGTGTACATCTAGTAATGGAGCTTTGTGC
solcap_snp_c1_6875 PGSC0003DMB000000154 1276425 AGTTTAGTCCAGAAGCTCATGAATCTAACATGTTA CATGACCTCATTAAG[C/T]GAACATCAAGGTTAA CAACTCTTTTTCTCAGCACAAGCTACTGACAAGTT
solcap_snp_c1_6890 PGSC0003DMB000000296 370584 TTGCAGAGACAATCAAGAACTTTGCTGTGATTTAC CTGGTTGACATCACC[G/A]AGGTCCCTGATTTTA ACACGATGTACGAGCTGTATGATCCATCCACCATC
solcap_snp_c1_6898 PGSC0003DMB000000296 124084 CTTCTCAAATATGACTCCACCCTTGGCATCTTTGA TGCTGACGTCAAGCC[G/A]GTTGGCACTGATGGA ATCTCTGTCGATGGAAAAATCATCCAAGTCGTCTC
solcap_snp_c1_6900 PGSC0003DMB000000551 190816 TCCTCAAGGGCAATATTACTCCCCTTGATCGCCAT TGTAGACCTTTGTGA[A/C]ATGGAGCAGTTTCCA CTTACTTTACGTTTTACTTCTGAGAAAGTAAGCGC
solcap_snp_c1_6901 PGSC0003DMB000000551 190834 CTCCCCTTGATCGCCATTGTAGACCTTTGTGAAAT GGAGCAGTTTCCACT[T/C]ACTTTACGTTTTACT TCTGAGAAAGTAAGCGCCCATTTCGGCTTCCATAC
solcap_snp_c1_6902 PGSC0003DMB000000234 77732 CCTAACAATAAAACCTAAAACCCTACGTTTATAAG TAAAAACCAGTGCTT[C/T]AGATTTTCGCCTCTT TGCTCCTCCGCAGCAACTAACTCTTGTGATCTCTT
solcap_snp_c1_6905 PGSC0003DMB000000551 110770 GATCAAACTGCACTTGTGACCCTTGCAATTGCTAA GTTGATGTATTCATG[T/C]GTGTCTCTACTAAAA CTATGCTTTAAGAGCTTTTATTTTCTGTAATAATA
solcap_snp_c1_6936 PGSC0003DMB000000334 333310 CTTGTCACTTCAGTTGCATCACTTATTGGTGTGGG GCTTTATAATGGGTT[C/T]TTAAAGAAAGTTCCT CTACGGAAGATATTCCTCGTAATGACTCTCATTGG
solcap_snp_c1_6937 PGSC0003DMB000000439 458651 TCATTTTCTGAACTAGTTTGCTTCCAGCCAGCATC ACATTCACACGCGAA[G/A]CCAAAAGTAGCATTT GAAGAAGCTTTACAATTCCCTTTACCACAATTCAC
solcap_snp_c1_6945 PGSC0003DMB000000439 287212 ATACACACCAAGGATGTGGTATGTGGTATATTACC AGAGATCTCGGGTTC[G/A]GGCTACCGAACACGG GAAGGTAAAACAAAAGAAGACAATATATACATCAA
solcap_snp_c1_6964 PGSC0003DMB000000392 161504 CCCTTTCACAGCCAGTTGGGCTCGAAATTGAGTGT TGATCCTAGATGTGT[G/A]CTCTAAAAGAATAAT TCTAGACTACTTTCTTCCGACTCTGATGATTTGAA
solcap_snp_c1_6967 PGSC0003DMB000000392 100874 TCTTCTTGATGAAGTTGTTAATGTTGGAAAAAACA TCAAATTATCAGAGG[G/T]TGGTGCAAAGGAGAA ACACAAATTGGACAATGAATTAATCTCTTTGGCTA
solcap_snp_c1_6970 PGSC0003DMB000000392 60323 GGATATTGTGGCGAAAAATGAGGATTAGCTTTGAG AAAAACCACGAGGGT[T/C]GGCCTAAGTGTACAA TGTTAGTCATGGCAAGCATGGTTGATTGCTCGCTC
solcap_snp_c1_6992 PGSC0003DMB000000087 424676 AAAGCTACCTGGGGAGGTCAATAATGGCTTACAAG ACTTGGTCAAAGTTG[T/C]TGTCAGTAATAGAAT TTTAGCAGATGGAAATGTTGCCTGGTCTTCACTCC
solcap_snp_c1_6994 PGSC0003DMB000000087 423890 AGATCAATACCCACATCTCCTACAAGTTGTTATTC ATTACCGACTTCTTT[C/T]GAGAAGTTTTCAAAT GGGGTTAAGCAACAAGCAAAGGTTAAGGGCTTGGA
solcap_snp_c1_6997 PGSC0003DMB000000087 423281 AAGCTTCTTCAGCATATGAACACAGATGTGAAAGT TGCTGGTGAGCATAG[A/G]TCATCTCTGTTGCAA GTGGTTAGCATTGTGCCAGCATTAGCAGGTGGGGA
solcap_snp_c1_7004 PGSC0003DMB000000087 390396 GAAAACTCTGCGTCAGATGCCATATTCCACTACGA CGATGCGGCACAGAC[G/A]AAGTTTCAGCGGGAG AAGCCGTGGGCGAGTGACCCTCACTATTTCAAGCG
solcap_snp_c1_7005 PGSC0003DMB000000087 390384 GGGTCGACACCGGAAAACTCTGCGTCAGATGCCAT ATTCCACTACGACGA[T/C]GCGGCACAGACGAAG TTTCAGCGGGAGAAGCCGTGGGCGAGTGACCCTCA
solcap_snp_c1_7029 PGSC0003DMB000000087 296455 TTGCAAGTTACAGCCTCGAGTGAAAAGAAAATCCT TATAATGGGAGGCAC[A/G]CGATTCATTGGTGTG TTTCTATCCAGACTTCTTGTGAAAGAAGGCCACCA
solcap_snp_c1_7031 PGSC0003DMB000000087 292550 TCATCTATTTCATTCCACCACCTTAAACCCACAAG AATACGTCCACTGAC[G/A]TTCTTAACCACCCAA AAGTCAAGAGCAGCTAAAAGAACAGTTATCACAAA
solcap_snp_c1_7040 PGSC0003DMB000000087 255267 TCTGAGACGACATTGGCCAAATCCTCCAAAGTATT TCCACCCTCAAAGAC[G/A]AGACCTCGAACTGGG TAATTAAGCATCTCCGATATCTTCACTCCAGCATC
solcap_snp_c1_7041 PGSC0003DMB000000087 255225 ACATTGTAAGGGATGTTGTTCTCTTGCAGACAAAT GCAAGAATCTGAGAC[G/A]ACATTGGCCAAATCC TCCAAAGTATTTCCACCCTCAAAGACGAGACCTCG
solcap_snp_c1_7044 PGSC0003DMB000000087 254766 CCTCCATGGGCTGTGGAGGTGTGACATCTAGATCC TCAGGAGAACCATCA[G/T]TGGCGTTCTCATTCT CTTCAACACTGAGACTAATAGCTTCAAAGATGAGA
solcap_snp_c1_7076 PGSC0003DMB000000062 871805 AACTTAAGATGGTTAAGATTGTAGCTGGACTTTGA GGTGTCCAAGAAAGA[G/T]ATTGACTTAATTTCA GTAGGAGAAAGCAAATTGAGGGCCATTTCAATTCC
solcap_snp_c1_7077 PGSC0003DMB000000062 872157 CTCTGCCGTCCTGGCTCAGCAACAGCCCTTCCAGG CCAGGCAGGAGGTGG[T/C]GGCGGCTGTGCTGAA CACTGAACCCTCTTAGCAAATGCCCCACTGCACCC
solcap_snp_c1_7078 PGSC0003DMB000000062 872214 TGAGTTCCTATAGAGCCAGTCGACCCAACAATTGA GATAGGCTTTGGACC[C/T]TCCCAACTCTGCCGT CCTGGCTCAGCAACAGCCCTTCCAGGCCAGGCAGG
solcap_snp_c1_7082 PGSC0003DMB000000062 876905 TCCTTTTACTGGGTAAACATGTTCGTGCTAACCGA AAAAACAAATCATAC[G/A]AGAGCTGGACTCAAA CCAGATGATGGTTCCAAACTGGCTGCATAGTCTCG
solcap_snp_c1_7096 PGSC0003DMB000000062 972929 CGTTCTCTTCCTCCTTCTTAGTCTCCTTTTCCGTA ACCATTTTGTTCTTC[C/T]TGTCTCTCTTTCGCT TTCTCTTCTTCTTAATTGACTCTTCTTCCGCAACA
solcap_snp_c1_7111 PGSC0003DMB000000062 1085167 CTTGGAGCTAATGCCATTCTTGGAGTTTCTCTCAG TGTGTGTAGAGCTGG[C/T]GCTGGAGCAAAAGCA GTACCTTTGTATAAACACATTCAAGAAATATCTGG
solcap_snp_c1_7112 PGSC0003DMB000000062 1085221 GGAGCAAAAGCAGTACCTTTGTATAAACACATTCA AGAAATATCTGGAAC[C/T]AAAGAACTTGTAATG CCAGTTCCAGCATTCAATGTGATAAATGGAGGGAG
solcap_snp_c1_7115 PGSC0003DMB000000062 1160143 TACAGTTGGCTATTGTAAATGCACAGATAAAGTGG CCAGCCGGGCCTAAA[C/T]CTCCATATCCAGAAG CCCTTCACCAATTCGTGACATGGATGCTTCAGCCT
solcap_snp_c1_7132 PGSC0003DMB000000062 817993 ATGGCATCTGCATCTATTGGGGTGTCCTTCCTGGC TTTTACAGCCTTTGC[A/G]TTTAGCTCTCTCATT TCTGGTTACAACTTCTGCAACAGAAACGCCTCATG
solcap_snp_c1_7133 PGSC0003DMB000000352 270381 GCTGCAAGTCAAAATTACTTCAGAAGAAGCTTTTG CAAGAGAAAGAACAC[G/A]ATATGATTCATTCTC CTATGATGACATTCCTACAACTTCATTGGCTCGAA
solcap_snp_c1_7136 PGSC0003DMB000000077 1615989 CTGCATGTTCAGCTTCCTTCAATGTAGAGAAGAAC TCCTGAGTTTCATAA[G/A]TTACCCCGTCAACGG TCACTTTTGACCTAAAACAACGGGCATGAGGAGGG
solcap_snp_c1_7139 PGSC0003DMB000000352 249308 ACAATTAACAATTGTAACCTAATATTAGAGCAGTT CCAAAGCCAAGACAG[C/T]GATTCTACTAGAAGT TGAATACCCATTTGACAATTTGTTACCATCTAGCA
solcap_snp_c1_7142 PGSC0003DMB000000501 368353 AATCAATGGGAGTCCTAGATTTCGTATCTTCCAGA GTGATAGAAGCACCA[G/A]ACTGGAGAAGGATGC TAGCAACAGCAAGATGACCAAAATGCAGGGCGCGA
solcap_snp_c1_7143 PGSC0003DMB000000501 361332 TCTGGTCTGAACCAGCGACTCGGACAACTAGATTC TGATGGTGAGCCTTG[A/C]CCAGTCATCACAGAG AAGCCAGTAGTTGTTGTCTTTGGACTATGAGAGAG
solcap_snp_c1_7144 PGSC0003DMB000000427 121213 GTACTCGACCTACATTTTCAGCCTTGAAACTATGT AAGAGGAAGACAGTC[T/C]CCCCATATTAACTGA ATTTTTCTTACAGTCCTAGGTCTAGGGTGAAGATC
solcap_snp_c1_7148 PGSC0003DMB000000129 1422563 ACGGAAGAAGAGATAGTGGCTCATTTGGAGGAGCA TGGTCCCATTGTGAA[T/C]ACAAAGCTTTTCGAA ATGAATGGGAAGAAGCAGGCTCTTATTCTTTTCAA
solcap_snp_c1_7150 PGSC0003DMB000000129 1422458 GAGGAGCAGGCAACTGAGGCACTTGTGTGTCAACA TGCTACATCCCTTGG[C/T]GGATCGATCATTCGG ATTTCGTTTTCTCAGGTGCAAAGCATCTGAGAAGC
solcap_snp_c1_7165 PGSC0003DMB000000129 1380617 NNNTTCTGCTTATGCTGTTTCTGTTTTTGATGATT TCCAATAAAGATGTA[A/G]ATTGTAACAGCAGCA GCTGCAACCCCAAATGAACAAATAGCACCAATTCC
solcap_snp_c1_7187 PGSC0003DMB000000129 1218908 CTAAACAAAATTGGAGATCTTAAATACTATGCCGG TGATTTGCAAGCTGC[C/T]AGATCACATTATTTT CGGGCGTTGGATGTTCGCCGCAATGCCATCAAGCA
solcap_snp_c1_7189 PGSC0003DMB000000129 1217478 TGAAATTTTGGAACATAGGACTATATTGACTTGCC ACAGGCATATTACTT[T/C]TGAAAATCTCACTTA TTCTACGGCGATTACACCGAAGTTTATCTCAGGTT
solcap_snp_c1_7190 PGSC0003DMB000000129 1208811 ATATGCAACCAATCGACGGGGAGCTGCTCTGGAAA TGCAAGTTTGTATAT[T/C]TCTTCAGTTATCTCT TACTCGACGTGCTGTATTTAGAAGCATTTCCTGTG
solcap_snp_c1_7192 PGSC0003DMB000000129 1208030 TGTTCATAGTCAAGAGCGATGTAAGACAACTTCTC CTTCACATCCCTAAC[G/A]ATTTCCCGCTCGGCT GTGGTGGTGAAAGAGTAGCCTCGTTCTGTGAGGAT
solcap_snp_c1_7227 PGSC0003DMB000000129 977706 CTCTCTTCTTCTCCATTAGCCCAACTCACATCATC CTTTCCTATTCCCTC[G/A]ACACTTTCTGAGTCT TCATTGAACACTGATTGCTCGGTTTCAGAAGAGAG
solcap_snp_c1_7267 PGSC0003DMB000000012 252997 GAATAGGTGCTCAGAGCAGCAACAACTGATCCAGT CGTCTCAAATGTTGA[C/T]GTGACATCTGGGTAG CTTTTCCATGATGTGCTGACTTTGAGAGATGGGTA
solcap_snp_c1_7268 PGSC0003DMB000000012 370076 ACTATCAACATACCGTCCAGGTTTCGCGCACCTCC TGGAATATTGTCCCC[T/C]TCTTTCTTATCTAAA GGTTTGACTTCTCCCGTCAAATGTTCAATAGTAAT
solcap_snp_c1_7281 PGSC0003DMB000000012 198691 ATTGAAGCTTGCAGCAGCAATAGGTACTCCCAAAA CTGCAAAAGTAACTA[A/G]CCAAAGTCCTCCGAG ACGTAGGAAGAAGGCCCCTGGACCCAATTCCGCCC
solcap_snp_c1_7325 PGSC0003DMB000000441 453795 ACTGTGAAGGTGTTCTCATTTGTGGAGAACCGTCT AGTGATCTCGCCCAC[G/A]GCTGCACTCTTCTTC AATTCATCTAGATGATGTATATATGATGCCTTTAT
solcap_snp_c1_7341 PGSC0003DMB000000441 346701 CAATCTCTGCAATACTCTGTAAGGCTGGTTTCCAT TGCCCCCCACCACCA[T/G]GATGTCTTCCCATAC TTCTTTGCCCACTGCTGCTACTGCTACTGCTTCCA
solcap_snp_c1_7342 PGSC0003DMB000000441 335009 CCTTCCAAGGAAGGGAAAGGAAAGAGATTATGGAA GAAAGTGAAGTACCA[G/A]CTTGTGGAGTATCAT TCATTGCCTGGGTATTTGAAAGACAACGAATACAT
solcap_snp_c1_7346 PGSC0003DMB000000441 286488 ACTGCTTGCTCTCCCTGTACCCCAACCTCAGTCCT GCTTATGGATAATCC[G/A]TTCTCCCGAAACACT CTTGTGACATCTGCTAACAGTCCTACCCTGTTTTG
solcap_snp_c1_7372 PGSC0003DMB000000609 19906 CAGTTTCATCACATTTCTGCAATTTCCAACCCAAT TTCTCCGAAAACGAA[T/C]GCATTTTCTCTTTCT GTTCTGCTGTAAATTTGGTCCTAAATCGCTTTCTA
solcap_snp_c1_7381 PGSC0003DMB000000592 163855 TGCACCAATATCATGCACTAAGATCTAGCCCTGCT AGAACATCATCTGTT[T/C]CATCCCCTAAGCCTA ACCAATTGATTTGCCGTGCACAAAAGCAAGATGAT
solcap_snp_c1_7382 PGSC0003DMB000000592 163911 CCTAAGCCTAACCAATTGATTTGCCGTGCACAAAA GCAAGATGATGCCAA[C/T]AACACCAGCAACGCC GTCTCTCGCCGATTGGCTCTTACTCTCCTCATTGG
solcap_snp_c1_7399 PGSC0003DMB000000592 189245 CTTCAATTCACCATCATATTGGAGCATACCAGCAT AATGGATTTTAGGGA[C/T]TCGTACACGATCAAA TTTGTCAAAATCTTCGTATTCAAGGGCCTTTGCAA
solcap_snp_c1_7400 PGSC0003DMB000000592 221630 CCAGGTTTGGAAGTCTATGAAGGGTGTGATTATTC TGCCAAAACATGCCG[A/G]TTATAAAAACTGCAT TGTGAAACTTCATAGGATATTGATATTTACTTTAT
solcap_snp_c1_7404 PGSC0003DMB000000592 268420 ATTTAAAATGGAATGCAGCTGCAAAGGAGAGCTTG CACTCGCTCACAAGG[T/G]GTGCACCTTAAAGTG GTTTAGTATTAAGGGTAACAAAATCTGTGATGTTT
solcap_snp_c1_7405 PGSC0003DMB000000592 37727 TAGAAACATGAAGAAATAGATAAGTCTAGGTTAAC GTGAGGATCGTCCTT[T/C]GTAGATTTCAAAACT TGCTTTGTGGAGGAATCATTTTGGGAATTTTGATG
solcap_snp_c1_7407 PGSC0003DMB000000592 39181 TGAAGGTGTCTTCATTTGGGATTTTCTTGGTATGT GTTGTGCCATTGGTA[A/C]TTGCTGTGATGAACT TGGTTTGGTTCTGGAAGATTGTGAAAGGACTTAAG
solcap_snp_c1_7412 PGSC0003DMB000000204 950705 TATTTGTGTGATCTCCAACCCTCAAATGACTCAAA TAATTTACAGGACTC[C/A]TTTGAGAAATCACTG TAGTTTAACATCAAATCAAGAGCAAGCATGGCACA
solcap_snp_c1_7430 PGSC0003DMB000000204 871465 CTCTGTTGAGACTGCAACTTTGGACTGCCCCAGAG AAACTGTGGTCCTGA[G/T]AGTGTTTCAACAGCA GAACCATTTGTACTTGAAGCACCAAAAGAGGACAC
solcap_snp_c1_7442 PGSC0003DMB000000204 621444 ACCTTCAACCTTGATTCCGAATTAGGACCTGCACA CAGCCTCATTGGACC[A/G]AATAATCCTCCTATT TTCCGAAGAGTTGTCGTGCAAAAATATTTACAGGA
solcap_snp_c1_7469 PGSC0003DMB000000204 987828 GGGAAGTAACGAATTTGAGCACTGAGTTGCAGAAA AAGGGTAAATATTGG[G/A]AAAGAAGAAGAAAGA AAAGGGACACACAGCGTTTAAAAGACGCAGTTCTT
solcap_snp_c1_7485 PGSC0003DMB000000331 606438 CGAACCTTGTGCATGTTGGGAAATTTGGCAACCAC CAGAATGAAAACTGC[A/G]AATGTGTTGAAGAAC AGCATTGGGTGTTGATAGTCAGTTGTATGGGAAGC
solcap_snp_c1_7489 PGSC0003DMB000000376 343188 ATTTTAGGAGTATATACATTGTGATACTTAAAGCA AAGATCAATGTTTTG[C/G]TTCCTTTTGGACCAT TGGCGATACTGCTACACTATCTTACGAAAAAACAT
solcap_snp_c1_7495 PGSC0003DMB000000376 108453 TTAGATTCATGGCAGCCAAATATTGTATATTTGCA AGGAGAACATCTTTC[A/G]AATGATGAAGTTGGT TCACTTGTTTGGGGAGGTCTTGATTTGTCTTCTGC
solcap_snp_c1_7514 PGSC0003DMB000000250 281387 CAACTTCCTCAGACGGAAATTGAATTGTCCGGACA GTAATATTGCTGCCC[G/A]AAAAGAGACGGTCTC TATCGACAGAGGACTGAAAAAGAAGAGCATTATGC
solcap_snp_c1_7515 PGSC0003DMB000000250 281215 TCAGCTAAATCAACAGTCCAAGGGAAGAACATATC GGAAACAATGCAGTT[T/C]GGATTGATCTCCCGA ATTAGTTGCTCCATAATCTTTTGGAGCAGAATAAA
solcap_snp_c1_7516 PGSC0003DMB000000250 281128 TAAGGTTTAAATTCCCTAATTAAAACCCAAGCACA TTGATGTATGGAAGT[G/A]GCTGGTTGAAAAGAA AATCTCGGAATTTGCATCTCCTCAGCTAAATCAAC
solcap_snp_c1_7517 PGSC0003DMB000000250 281098 AACCTTTCAGAATCCGACGCCACATTCTTGTAAGG TTTAAATTCCCTAAT[T/G]AAAACCCAAGCACAT TGATGTATGGAAGTGGCTGGTTGAAAAGAAAATCT
solcap_snp_c1_7520 PGSC0003DMB000000250 280114 AAGAAGCTCAAAAGTGCCACTGAAGAAGGTGGTTC CTCTCATTCACAGCT[C/T]ATCGGGTTAATTGAG GAGATCAAGCGTTGTGCTTTCAAGAAATCCTCTTG
solcap_snp_c1_7521 PGSC0003DMB000000250 280067 GCTCATCGGGTTAATTGAGGAGATCAAGCGTTGTG CTTTCAAGAAATCCT[C/T]TTGAAATTTTATGTT TTACTTATCACTTTGAAATAAATTTGGCAAATGGA
solcap_snp_c1_7530 PGSC0003DMB000000332 273561 TTGAGTAGACCTACTGATTTACAAAATGGCCCCCC AAAACCAGCTTCTGA[G/A]TTTACTGTCAAAGGA GGAGAGAAAGTCAATATTCAAATTGAAGGCATTGA
solcap_snp_c1_7562 PGSC0003DMB000000051 2199826 ACAAGTCGAGCAATATGATCAATTTTTCTTTGAGA TAAAAATACATCAAC[A/G]CCAAAAGGATAATAT GCAGCATTATTTGCCGCAAACTCTTTCTTTTTGTC
solcap_snp_c1_7567 PGSC0003DMB000000573 75881 TTTATTCCATATTCATTACATGCAGCTACAACATC TTCTTGAGCTTTGTA[A/T]AGCTCCCACGCAGCA GTGAAACGGCCAGCATCTTTTCCAGAATCAGAATA
solcap_snp_c1_7568 PGSC0003DMB000000573 78030 GGAGGAACCAAAGGCCTTTTCCCCTTTAGCTCTTT GATCAGAAAGTCCAG[C/T]TTTTGTTCTTCATCC CACTCACTATATGTACCCATGTCCAAGTATTTTGT
solcap_snp_c1_7569 PGSC0003DMB000000573 78494 AGCAGTGGTTCCAAAAGCTGATCTGATGTTTCATA ATAATCCATAGGATC[G/A]TGGTCACATGGAAGA TCTTCAAGAAGAAGCTCCAGCCGCTTCCGTGACTT
solcap_snp_c1_7570 PGSC0003DMB000000573 82211 TTTACATCCCCAAGGACAATTCTATAAGGCGCAAT TCCAGGTTTATGTGA[T/A]GAGCTTGGTTCCATT AGCTTTTGGAAGCTGGCCCTTCCGACCTGGGTCTC
solcap_snp_c1_7571 PGSC0003DMB000000573 82250 GGTTTATGTGATGAGCTTGGTTCCATTAGCTTTTG GAAGCTGGCCCTTCC[G/A]ACCTGGGTCTCGGCA AAAAGTTTCCTTTGGAGAAGCTGACTAGAGCTTAA
solcap_snp_c1_7574 PGSC0003DMB000000051 1878960 GGAGCAAAAGATATATCTTTGAGGAAGAGAATGAT TGAGTATTTGGAACC[T/G]CTTCTTGTGAAGAAC AATGTGAATCTTGTATTGTGGGGGCATGTTCATAG
solcap_snp_c1_7621 PGSC0003DMB000000103 1353153 CCCGAGGAAGTCATCTTTGACCAGTTACATACTAC TGCATTCCAATACAC[C/T]CCATTGGGTAGAACT ATTCTTGGACCTGCACAGAACATTGAGAAAATGAC
solcap_snp_c1_7622 PGSC0003DMB000000103 1353123 ACTACTGCATTCCAATACACCCCATTGGGTAGAAC TATTCTTGGACCTGC[A/T]CAGAACATTGAGAAA ATGACAAGAGCTCATATTCAAGATTACATTTCAAC
solcap_snp_c1_7624 PGSC0003DMB000000103 1332020 TTGGTTGTGGATTTGGTAGCTTTGGTGCCCATCTA CTTTCACTGAGGTTG[A/G]TGGCTCTTTGTGTGG CACCATATGAGCCATCTGGTAGCCAAGTTCAGTTA
solcap_snp_c1_7632 PGSC0003DMB000000103 1672383 TAGCAGTAGGGGTGAGAGCAGGGGAGAAGAAGGTT TTACAACAACTCGAC[G/A]ATATTTTTAGAGAAA GAGAACTGGAACTAGATGAATTAGAGTACTACCAA
solcap_snp_c1_7656 PGSC0003DMB000000549 204945 GCAATCGCATCACCAAAACTAAGCAGCATAGCAAC ACTCCCAGTAGTAAC[G/A]TCAGCAAAGCATTGA TCTTTGATCTGCTCAAATCCTTCAAACATTTGATC
solcap_snp_c1_7658 PGSC0003DMB000000549 141006 AAGGGCTGTATACTCCTTCCTTAGATGGTCCAAAG AATGTGTTAAGCAGG[G/A]CCTCTTTCACATCCA TGTATCTCTCTGTGAAATACAGAGGCTTCAGGGGA
solcap_snp_c1_7666 PGSC0003DMB000000131 396984 GAAACAATTTCAAATCTTCCCGTTGCAACTAAAGA TGATGATGGAGAAGA[G/A]GCTGCTGCTTTGATA GAAAAGACAGAAGCCGTGAATGAAGAAGCCGCCCA
solcap_snp_c1_7678 PGSC0003DMB000000345 68384 CCAACCATGGCTGTAATTGATGGTCCTCTGGAGCC TTCATCGTCTACTGC[G/A]TCAAATGCCCCACAT CTCCCTGAGGACAATTCCTTTGTGAACTTCTTCAG
solcap_snp_c1_7679 PGSC0003DMB000000345 113328 GAGCCAACAAAATTACCTTTCTAATGACTTGGGAA GTAGGCCTGAAATGG[G/A]GAGTCATTACAATAG AATGGGATATGAAAACATTGATTTTCAGAGTGGGA
solcap_snp_c1_7680 PGSC0003DMB000000345 113338 CCATGCCAGTGAGCCAACAAAATTACCTTTCTAAT GACTTGGGAAGTAGG[C/T]CTGAAATGGGGAGTC ATTACAATAGAATGGGATATGAAAACATTGATTTT
solcap_snp_c1_7681 PGSC0003DMB000000345 114820 CACCAAATGCAAATAATTGTATCATCATTTGAGCA AGTAGCAGGAATTGG[T/A]TCAGCCAAATCATAC ACTCAATTAGCTTTGCATGCAATTTCGAAGCAATT
solcap_snp_c1_7682 PGSC0003DMB000000345 115740 AGGCTCTAAGTATCTGAAAGCTGCACAAGAGCTTC TTGATGAAGTTGTTA[A/G]TATTGTTGGAAAAAG CATCAAAGGAGATGATCAAAAGAAGGATAATTCAA
solcap_snp_c1_7688 PGSC0003DMB000000345 375039 TTGGTTATTGAAGAAATAACTGAAGAAGAACCATT AGTGTCTTCAGAAGC[C/T]GTGGATAGTTCATTT CCAAAAAGTGTTGCATCACAACCACGTGAATCGAT
solcap_snp_c1_7695 PGSC0003DMB000000345 519063 TCATCATCCACCACCTGCTCTGCCTCAGTCTGTGG AGCAGCCACCTCCAC[G/T]TCCTTAAGCGGAGCA GGAAAGAAATCAAGATCCCCACAGAACCCCATTTC
solcap_snp_c1_7700 PGSC0003DMB000000345 532481 AAAAGTAAGGAAGGTGTCGATCCTGCAAAACAACG TCAGTCGCAGGAGCA[G/A]GCGAGGAGGAAGAAG ATGTCAAGGGCACAGGATGGGATCTTGAAGTACAT
solcap_snp_c1_7704 PGSC0003DMB000000345 574197 ACTGATATAAGCCATAGACTTCAACATGGGCTCTA GTGTGACCTGGGATA[A/G]CTGAAACTTAACTTC TGATTCTCGTGAAGGAGTCCTACTGTAATCTTGCA
solcap_snp_c1_7707 PGSC0003DMB000000055 2158104 TCCATTTTTTGCCTCATAAGCTTAAGTTTTGAAGT TTTTGTTACTGAATT[C/T]GGGTGCGTGCAAACA TTTGTTGAATGTGAATGTGGAAAGAGCAGAAGATG
solcap_snp_c1_7722 PGSC0003DMB000000040 2481291 CCTGAGAGGATAGATGTGCTGCTTACATTAACCCC AGAAGCAGAAGTTCC[G/A]GGCCCTTCTTGTTCA AGAGGTCTAGCATCTCCAGAAGGGTGTGACATAGT
solcap_snp_c1_7739 PGSC0003DMB000000361 131713 GTTCCAAGGATCAATGAGAGTTTATCGCCCGCATC TTTTGATTCTATTGT[G/A]GTCACAGAAAGTGAT ACGAAGGTTGATAAATTCACAAGTACCAGTCCAAT
solcap_snp_c1_7740 PGSC0003DMB000000361 128212 CCTGATAATGCTGGTTATTACAATTCTAAGCCACA TGAAACTGGATTCTT[C/T]TGTGAGCGAGGTGAT TATGATAGCTACTATGGGAGATTTTTCCTCCATTG
solcap_snp_c1_7744 PGSC0003DMB000000283 530723 TCATATTCTTCTCAATATACTGTTGGTGGCAAAGA TGGTTGGGTCCTTAA[C/T]CCTTCTGTTGATTAC AACACTTGGTCTCAACATATGAGATTCATAATCAA
solcap_snp_c1_7746 PGSC0003DMB000000283 511924 ACAAATATCCTTCCCATTTTCAATGGAAAATCAAC AAAACCCACAAAACA[A/G]GAATTGATTTTTTTT GGTCAGTTGTGATAGTCAGCTAGTGAGCTTGTGGG
solcap_snp_c1_7754 PGSC0003DMB000000283 360816 ATGCTTATAACTATTATTTGGGGAACCTGTTGCAT TGTTGGCAAGTGCGA[T/C]ATACAAAATTCTGTT GCTGTAGACATGAAAGACACTAGAGGATTCAGCTT
solcap_snp_c1_7765 PGSC0003DMB000000283 239191 GAAATGACTACTAGGAATTTGGAGAAACTTGCATC AATTGATGCACAGTT[G/A]AGGCAATTGGTGCCT GCTAAAGTTTCTGAAGATGATAAACTTGTTGAGTA
solcap_snp_c1_7766 PGSC0003DMB000000283 239176 TTGACTGTTGAGTGAGAAATGACTACTAGGAATTT GGAGAAACTTGCATC[A/G]ATTGATGCACAGTTG AGGCAATTGGTGCCTGCTAAAGTTTCTGAAGATGA
solcap_snp_c1_7770 PGSC0003DMB000000140 370342 TCTTCTAGAACATTCTGCAACAGCGGAGAACTTGA TCAATCTTCATCGGC[T/C]CCACACTACCAACGA ATCACTGAATTCTCTCAACTTTGAAGATTTCAGAG
solcap_snp_c1_7776 PGSC0003DMB000000338 509188 AGAAACATCTCCAATGGGACATCGAAAACTGCTTC TACTTCAGAAACATT[G/A]GGGGTGGGATTGAAT TCCTTTTTATTGGAAAGAATCCCAATCACGGGAAT
solcap_snp_c1_7777 PGSC0003DMB000000338 509185 AACATCTCCAATGGGACATCGAAAACTGCTTCTAC TTCAGAAACATTGGG[G/A]GTGGGATTGAATTCC TTTTTATTGGAAAGAATCCCAATCACGGGAATTAC
solcap_snp_c1_7793 PGSC0003DMB000000338 295610 GCGTAAAAGAAAAGTTGAAGAATGACCCATATAGA TTTTGCAAGAACATT[C/T]TTCACTACATGGGCT TCAGTTTGGCTCGGGATGTCCATATCAATTCCATC
solcap_snp_c1_7794 PGSC0003DMB000000338 295474 CGTGGATAGGATAAGATAAGCTAGCGATTTCCAGC CCCAGAAGTAAACCA[C/T]AGCTCCATCAAGGGA TAGCTGGATAGTAAAATTAATGAACTCCCACACAC
solcap_snp_c1_7801 PGSC0003DMB000000338 255446 TCTTTAGAAGGCCTTGATTTTGTCTTTGAGTACAA CCCAAATGCTTTAGT[A/G]CATGGCCTTTGCAGA GTTTCTAGTTCAGTTGAATGATCAATGATTTCCCG
solcap_snp_c1_7803 PGSC0003DMB000000338 254878 CAACATGATACTTGGTGGAAACAAAAACTATAGTT TGCTGATCAGAAGTT[G/A]TTTGTTCACGAATCA GATACAGAAGTGCAGCATGCTTCTCCTCCTGTCTT
solcap_snp_c1_7805 PGSC0003DMB000000338 254678 AGGGCACTGGGTAAAGTTGCACTGAAAAGCAGAGT CTGGCGATTCTCACC[T/G]AGACGGGTGAGAATT GTATGCAATTGCTCAGCAAAACCCATGCTAAACAA
solcap_snp_c1_7829 PGSC0003DMB000000055 466500 AAAATAATGAACCTTAATGAAGCTCGGGCTACAGA AGGTGTTCCTGTTTT[G/A]CCCGATGATGACGAT GATGCTGTTGATCCACATCTTGAGCGTATTAAGAA
solcap_snp_c1_7829 PGSC0003DMB000000004 2310457 AAAATAATGAACCTTAATGAAGCTCGGGCTACAGA AGGTGTTCCTGTTTT[G/A]CCCGATGATGACGAT GATGCTGTTGATCCACATCTTGAGCGTATTAAGAA
solcap_snp_c1_7834 PGSC0003DMB000000004 2258094 TTTCAAGTTCATTTTGAGGCTGATCCTGCACTGGC TCTATGTGATGATTC[G/A]AGAATTTCCTTGGGT TGCGTTTAGCCTTTTCTGGTTCAGAGGAACTAACG
solcap_snp_c1_7848 PGSC0003DMB000000004 2165405 GAAGCCATTCTGAGTTAATCAGCAGGCCAGAAGGT GCATATTCTAGACTA[C/T]TGCAACTACAACACC ACCGCATATGATGAAAATTACAAGAATCTTTTTTT
solcap_snp_c1_7867 PGSC0003DMB000000004 2070140 TCCATTCTTCTTCATAGTGGAAATCAGTTCCACCC CAACTTACCCCTTTT[A/C]GCACTTAGGCCCAAA AAATTATCTCTAATTCATGGCTCCAGTAGAGAGCA
solcap_snp_c1_7868 PGSC0003DMB000000004 2070074 AAATTATCTCTAATTCATGGCTCCAGTAGAGAGCA AATGTGGAGGATCAA[G/A]CGCGTTAAAGCAACA GGTGAAAATTCTGGGGAAGCTGCAAGTGCTGATGA
solcap_snp_c1_7869 PGSC0003DMB000000004 2069221 GATTATAATGTTACTGTACCTAGTACTGCTGCTAC TCCAATTACTGATGT[C/T]GATAAAAATACACCG CCTGCTATAAGCCAAGATTTTGTTGAAAGTAAAAG
solcap_snp_c1_7870 PGSC0003DMB000000004 2069149 ATAAGCCAAGATTTTGTTGAAAGTAAAAGAGAAAT CAAAAGGGACCTGGC[C/T]GATGAAAGGGCACCC CCACTGTCGAGATCATCTATCACAGCCAGTAGCCA
solcap_snp_c1_7871 PGSC0003DMB000000004 2069125 AAAAGAGAAATCAAAAGGGACCTGGCCGATGAAAG GGCACCCCCACTGTC[G/A]AGATCATCTATCACA GCCAGTAGCCAGATTTCCTCTACTGTAAGTTCCAA
solcap_snp_c1_7872 PGSC0003DMB000000004 2069006 TCCAGAAACTCCGAAGTCCAGTCAAGAGACACTTT TGGATGTGAATTCAC[G/A]CAAAAGTTTAGTAGA TGTTCCTGGAAAGAAGATCCAGTCTTATATGCCTT
solcap_snp_c1_7873 PGSC0003DMB000000004 2068993 AAGTCCAGTCAAGAGACACTTTTGGATGTGAATTC ACGCAAAAGTTTAGT[A/C]GATGTTCCTGGAAAG AAGATCCAGTCTTATATGCCTTCATTACGTAAAGA
solcap_snp_c1_7874 PGSC0003DMB000000004 2064881 AAGACTTCCCAAGGTGGTTGGGGATTGCATCAGAT AATTAATGAGAACGA[T/C]TGGAAATTACAGGGT ATTGTGAATGGGATTGATACAAAAGAGTGGAACCC
solcap_snp_c1_7876 PGSC0003DMB000000004 2064443 ATAACTGCTGGTGCAGACATTCTGCTCATGCCTTC TAGATTTGAGCCTTG[C/T]GGACTGAACCAGCTT TATGCAATGAAATATGGGACTATTCCTGTTGTTCA
solcap_snp_c1_7882 PGSC0003DMB000000414 478413 TACTGGAATGTACTAAAAGGAAGAAAAGATGGAAG GGTGTCAAGGGCCAA[T/C]GAGACAGTAAACTTA CCTGCTCCATCCTTCAACACAAGCCAACTCATTCA
solcap_snp_c1_7912 PGSC0003DMB000000423 457555 AATGCCCGAGAAGGATCATGGTGAACACAACTGGA TTCAGGGCAAACATA[C/T]ACTCTCTTCTTCACC TCATTGCTTGATCTCTGCCTCAGCTTCCATGGCAA
solcap_snp_c1_7915 PGSC0003DMB000000423 493920 GGCGCGCTACGAGCCCGTGTTAGTTCGGGCCTCCG CACCAGAGGAGGACA[C/T]GGGCCAAATCCATTC ACCACTGCGGGCCACCAGGATCGACCTAACGGATA
solcap_snp_c1_7935 PGSC0003DMB000000020 66462 AATTAGGCATAGTGCCTGCCGTGCCATTAGGAGCT TACTGTACCTAATCG[T/C]GCTGAGTAGATAAAA AACATAAACTTTTTTGACCGCTGCATCAAACATGA
solcap_snp_c1_7947 PGSC0003DMB000000020 135674 GTTGGGATTCCTCCCATATTATAATGCACGGTAGG TAAAACAGGAATTGG[C/T]TCCTTAGTCACATCA ACACCAGCGAAAATGGCAGCTGTTTCAGAGATACC
solcap_snp_c1_7948 PGSC0003DMB000000020 136169 ACTTGAAAAGGATGCTGGAGAGAGGACCATCGCAT GGTTGGACAAGATTA[G/A]GAACTCAAATGGTTC ATTGCCCACCTCAAATATAAGGCTGAACATGCAAA
solcap_snp_c1_7957 PGSC0003DMB000000423 365598 GTCAAGCTGCAATGGGTTCGGTAGCCTTCTTCAGC CATTCCATCTCAGAT[T/G]TATTCAGGTAAGGAG TAAGAATTTCCCTACATTTTGCATGGTATTCATTT
solcap_snp_c1_7963 PGSC0003DMB000000020 405683 GGCCATTTCTGTCGCACCATCTTAGCCACATCGTA GATGATAGCATGATG[G/A]GACGAGCAAATGAAT CTTCCCTCTGCCTTGGGGTGCTCATACAGGAATAT
solcap_snp_c1_7964 PGSC0003DMB000000020 405972 AAGAAGAATAACATTGATCTCATTAGCATCATACC ACCACTGGTTGTTGG[C/T]CCATTCATCACACCT ACGTTCCCACCTAGCTTAATCACTGCCCTTTCACT
solcap_snp_c1_7973 PGSC0003DMB000000313 548754 TAGCTGGTCACTTCACCCGCTGGAGAAAACATTAG AAGACCAACATCAAC[G/A]TCACATAAAACAGCC AACTCATTTGACTTCTTAAGAATGGTATCCTTGCG
solcap_snp_c1_7980 PGSC0003DMB000000313 441124 TTCTGGACTTTAGCATAAAAAGAGCCAGCTTCAGG TAAAGACAAGCAACC[C/T]CTGCTCGCCTTGAAA AGACAATTCTCCGGATCTGCATTAGCTTGGTTATA
solcap_snp_c1_7989 PGSC0003DMB000000313 337614 CTTGTACTTCTCTTTGTGCCTGTCCACATCTCCGA GGTATGCTTGCAAAA[A/G]TTCAAGGTCTGACTT CATCTTCTGAAACTCATGTTCAAATCCAAGAACCT
solcap_snp_c1_7990 PGSC0003DMB000000519 6135 ATAAAACAGAGAGACATGACCACGTTTGAAACTCC CCATGTGAAACCAGC[C/A]CCCCATTTTCGACAG AGCTTCTCCATGAACAATGAAGTTAGTCCAAGAAG
solcap_snp_c1_7991 PGSC0003DMB000000733 22648 CCAATTGAGCATTTGCATAACCTATGATTACACAT AATACCAAAACACTC[A/G]TCAAATAGCTAAATG AAGCCATTTGTTATTTGCTTTGTCTCAAAGAAACT
solcap_snp_c1_7992 PGSC0003DMB000000733 22646 CTCCAATTGAGCATTTGCATAACCTATGATTACAC ATAATACCAAAACAC[T/C]CATCAAATAGCTAAA TGAAGCCATTTGTTATTTGCTTTGTCTCAAAGAAA
solcap_snp_c1_7993 PGSC0003DMB000000733 22613 AGCTTTTGGACAGCTTTTAGCATAGAAATTAAGCT CCAATTGAGCATTTG[C/T]ATAACCTATGATTAC ACATAATACCAAAACACTCATCAAATAGCTAAATG
solcap_snp_c1_7994 PGSC0003DMB000000733 22209 TTCAGCTTCAACTAATCTCTTCACAGCATCAATGA ATGAGAAACCTCTTA[C/A]TGTCAGATTAGGATT AGCTAGTTTTTCCGTCTGATTTCCGTTAGTCGAAG
solcap_snp_c1_7999 PGSC0003DMB000000116 285624 TCTTCCGAAAATCGAGTTTATTGACAAAGACTATA AGACCAACGGCCAAT[G/A]CTGTTAAACTGATCG TGTACTTTGTTTTTTCACTGATGGCAATATGCTGA
solcap_snp_c1_8002 PGSC0003DMB000000116 600484 TCAGACGTCCACAAGGTGAGATTGTCCCTCAGAAG CTGCAGAATTAAGGT[G/T]CCATCTTTGTAGTTG TCCTCATTGAGGCTATCCAGCTCAGATATTGCTTC
solcap_snp_c1_8004 PGSC0003DMB000000116 67402 AGCAGCCCGGTCAAGTATGACGGAACTCAATCCGA TGAGTACGTTTTTTA[C/T]CCGGATGGCCGGGAG AAGATTAGCGACATTCTCTGCAAGCTCCGTAAATT
solcap_snp_c1_8013 PGSC0003DMB000000475 83655 AGAGCACAAGTCGAAGCAAAAAAGGGTCAGGTCAA CTGCAGAGAGCTGAT[A/G]AATACTGCCATTCTT ACCATATCTGAAGCCGGTGGAACGGTTGATTATGC
solcap_snp_c1_8018 PGSC0003DMB000000385 508499 CCTCTAAAAATGCCAAACTGGATTCATATAACGGA TACAAAGGAGTTATA[G/A]AGATTCATGGATCAA CGGTGCAAACAAATTTAAGCATAGCTCTGTCTGCA
solcap_snp_c1_8019 PGSC0003DMB000000385 508444 GCAGGAGAATCTGGAAGCACTTTTTCATCAAATTT GTGTCAGGCTTCGGC[G/A]GAGTCCTCTAAAAAT GCCAAACTGGATTCATATAACGGATACAAAGGAGT
solcap_snp_c1_8020 PGSC0003DMB000000385 508327 GAACCAAATAAAAGAGAGGGTTCTGACAGTATTGA TCCAGCACTTCTGCT[T/C]CTACACCAGAATGAC AACACCAATAGGCCTATAGGCCAAATAAAAATGGA
solcap_snp_c1_8021 PGSC0003DMB000000385 508229 CCCCAAATCATGAGAAGCCCAAAGCTTTTGGAACT TCGATCTCAAACAGT[G/A]TTGGTGAAACAGCTT CCACTTCTCTGGGCAGTCAGATAAATGGTTCAGAA
solcap_snp_c1_8036 PGSC0003DMB000000126 217906 GCTTTAGAGATGGTCCAAGCTATCCCGCCTGATTT TTGTAAAACCGTCCC[T/C]ATATCAGATGAAGAG GTTACTGCACTGCCACCAGATCAAGCTAATCGGAT
solcap_snp_c1_8058 PGSC0003DMB000000126 336873 ATTGTTGGAGAGATCAAAGCAGCTAGAGAAGCTCT TGTTGAAGTGACATC[G/A]AGGCTTCGGAGTTTT ACTTATCGGGAGTTCTTTCAAAAGGATATACCCTC
solcap_snp_c1_8059 PGSC0003DMB000000126 336978 GCAATACCTGCCTCAAGCCCTGCTAGGAGTACTAT TGGAGCAGACAAAAA[T/C]TCTTTCAATAACACA TCTCCATCTCAACAAAACTACAGTGTTAATGATGT
solcap_snp_c1_8069 PGSC0003DMB000000126 544615 TTTAGACCATACAATTGCCCATATGCTGGATCAGA ATGTTCAGTGACTGG[C/T]GACATCCCTTATTTG GTTTCACATTTAAGAGATGATCACAAAGTGGATAT
solcap_snp_c1_8084 PGSC0003DMB000000014 343915 AAAGCTGAAAGCCCAACTCCATAAATACCCACCCT TCTTCACAATTTCCC[C/T]AGTACAAAACAAGGA CCTTGCACTACTCCAAAAGGCAGCGGGTTACAACC
solcap_snp_c1_8091 PGSC0003DMB000000020 983031 CTAGTTTCAGTTCCTGGACTAGGGGAGTACATCTC TGGTGCAATCCTCTT[T/C]GAGGAGACACTTTAT CAATCAACCGTCGAGGGAAAGAAAATGGTTGATGT
solcap_snp_c1_8113 PGSC0003DMB000000020 766803 TAAAAGTTTACAGTGTTCCAATCTTTTTCTCTGCA AGCAGTCCCTTCGGC[C/T]GAACCGAAGCCCTTC CCCAATGCGTATGGCTGAAATCCCATTGCGGTTGT
solcap_snp_c1_8118 PGSC0003DMB000000020 760299 CTTCCTGAGACAATACGAATTTTGTCAGGCAAGAG GGACACCTCCGCGAG[T/C]AAACGTGCTTCACTG AAACCTTCATCAACACGCCTAGAATGTGGTTCCAA
solcap_snp_c1_8125 PGSC0003DMB000000020 731144 AGGCAATTACTTGGACACAAGCACTGTGGTTGCTC TTCAAAGCAAAAGTG[G/A]ACTGACTTGCTGTGC ACCCACATTGCAATTAAGCCTGCCCTCCATAAATT
solcap_snp_c1_8127 PGSC0003DMB000000020 647818 AGTGATGTGATCTCAAGGACGAAAAATGAAAGAAG CTAGAAGAATACAAA[G/A]AGAACAATGGAAAGA TACATAACAATTATTGAATCAGTTTCTGCAAATGA
solcap_snp_c1_8127 PGSC0003DMB000009804 162 AGTGATGTGATCTCAAGGACGAAAAATGAAAGAAG CTAGAAGAATACAAA[G/A]AGAACAATGGAAAGA TACATAACAATTATTGAATCAGTTTCTGCAAATGA
solcap_snp_c1_8128 PGSC0003DMB000000020 641428 GATTTGATGTCATTGATGATATTAAATCTGCACTT GAGAAAGAATGCCCA[C/G]AAACTGTCTCTTGTG CTGATATCTTGGCACTTGCTGCAAGGGACTCCACT
solcap_snp_c1_8129 PGSC0003DMB000000020 568025 CAAATAGCCAATCCTTTATCTTCTCTGTGTCACCT TCCAAACCAACTACC[T/C]GAGTGTGGTCATAAA GGGAAGAAGTCCATCTTGTCATTAGATTATCGTGT
solcap_snp_c1_8131 PGSC0003DMB000000158 768107 GCTTGAAGATTCTTTAGAAGAACGGTTAGAAAAGA CAGGAGGTTCGGTTC[C/T]AGACTCAGAAAAGTT TGACGGAGATCCTAAGGAAGGAGAAGTGGAAGAAA
solcap_snp_c1_8132 PGSC0003DMB000000158 775130 GCAACCGGATCAAGCGACAAAACTGTACGCTTGTG GGACGTCCAGAGCGG[C/T]GACTGTGTCAGAATT TTCATTGGTCATAGGAGTATGATCCTATCATTGGC
solcap_snp_c1_8133 PGSC0003DMB000000158 775176 GCGGCGACTGTGTCAGAATTTTCATTGGTCATAGG AGTATGATCCTATCA[T/C]TGGCAATGTCTCCTG ATGGTCGATATATGGCATCCGGTGATGAAGATGGA
solcap_snp_c1_8136 PGSC0003DMB000000158 940979 GAAGTTGTATAATGGGCATTAGCATCAACAGGTGA CCCTGCCAACAGACA[G/A]TAATCCCCGATAGTT TTTTGTGCACGCCCCAATCTTCGTTTTTTAGCCTT
solcap_snp_c1_8140 PGSC0003DMB000000158 1210009 TCGGAATTTGGTATGGATCCAGCACTAATGGGAGA TGCAATAGAACCAGG[A/G]AGAGTAACATTTGAT GAGAAAATGGAAGTGAGAAAAGCCATAGAAGAAGC
solcap_snp_c1_8144 PGSC0003DMB000000102 728903 TTGGAGCGTCCTGGATACCGTGTTGCTCGTCGCCG CAGGTGCAAGTCTCG[T/C]GTCGGGATCCAGCAC AGGGTCACAAAGGAAGATTCAATGAAGTGGTTCCA
solcap_snp_c1_8150 PGSC0003DMB000000102 792724 TTTCTTTCTATGCAAGAACCATCTGTAGCGTCTGT ATAGGATTGCATCAC[A/G]GGTTCAGCAAGTTGC ATCCACCCAAAATCAGAGGTCTGACTGCATACTTC
solcap_snp_c1_8164 PGSC0003DMB000000613 140345 GAAGGGCCCGATGGAAGTAACTTGCAGCTTCAGTT TAGGTCTAGGCTATC[G/T]TTGCCTCTGTTCACT GGAGGCAAAGTAGAAGGAGAGCATGGTGCTGCTAT
solcap_snp_c1_8173 PGSC0003DMB000000300 769797 CTTTTGGCACCTAATCCTTGGGATTTAGGACGTCT AACAGCAACTAAAGG[A/G]TTGGTTATGCCTTGT GAACTTCTCCCAAGTCCCATGCCTTCAACAAAACC
solcap_snp_c1_8186 PGSC0003DMB000000300 456170 CTGAATAGCTCAGTCCCAGTTGGCTTAGATTCATT GTATTCTTTTGTTCC[A/G]GAAGTAACAGTGAGG TCAAGGTAGATATTTTTGCTTGAATATGACTTGTT
solcap_snp_c1_8194 PGSC0003DMB000000482 405485 AACATACCCATCATGTCCTTTGCGGAACCCATTTG CTTCATTAAGTTCTG[C/T]AAACCACCCATTCCA CCTATCTGCTTCAACATCTGAGGGGGGAGGACTTT
solcap_snp_c1_8203 PGSC0003DMB000000482 153842 GCTCAAGCTGGTGAAGAGAAAGCTGGGGGAATCCT CCAGCAGACTGGACA[A/G]CAAGTGAAGAGCATG GCTCAAGGTGCTGCTGATGCTGTGAAGCACACTTT
solcap_snp_c1_8210 PGSC0003DMB000000326 585404 GTTGTTGGTGAATTTCTGTGATGAACATATTTGGG ATAGTGACGGGGAGA[G/T]TAAAGAAGCAATGAC AAGAATAACGGCAACCAAAACGGCCGGCGAAGACA
solcap_snp_c1_8212 PGSC0003DMB000000326 585164 AGAATAACTCGAAATATCATACGTTTTCACCACCA TTTCTCCTTTGGAAT[T/G]TTTGAATGCAAACAA TGTTTGCGCCCCAACCATACCGGGAGCATTAGGAT
solcap_snp_c1_8215 PGSC0003DMB000000318 381921 CCAGAAAGCATCTTTTGAAAGGCAAGCAGATCCCC AGATTGAGCGAACCC[G/A]TGAATGGTTGTGGGT CTGGAGGACTTTGACCGTTGATGTCGTGACCTCTG
solcap_snp_c1_8235 PGSC0003DMB000000281 573840 AGATGAACAACACCAGCATGTAACCAGATACAAGT GAAAAGCCTCCAGCC[C/T]TGATGTCCGTGGACT ACTTTATCCCATTCTAGAGCTCCCAAATTTTGTAG
solcap_snp_c1_8237 PGSC0003DMB000000281 738486 GAGTTGCCATTCCTGGTTTGGCTACGGGTTACACG TGTCGACAATGGCTC[T/C]CCCACAGTTGCCTTT CTCTTTGGTGCCATTAGAGAGATTTCTAGGGTTTG
solcap_snp_c1_8255 PGSC0003DMB000000281 481882 TGTTGGATCATCACCTCTTGCTGCTGTAGAAATCC TCAAAACCCATGATA[A/G]AATTCTGTCAGGGAG AGATGTTCCAAGTGCTGCTCCATCAAAAGGGTCAG
solcap_snp_c1_8282 PGSC0003DMB000000281 402812 GAAATGAGGCACCAGATAGAGATACAACCCCATAC ATATAGCAGCTTGAA[A/G]AAGAGCCCTTAAAGT TGATCCAAAAGGTGAGGGTTTTCCTTTCTCTGAAG
solcap_snp_c1_8291 PGSC0003DMB000000281 309858 CTGATGTCGGCGTCGAAGCACATAGATATTAGATG CCGGAGCGAGAATGT[A/G]GCATATCTCAAGTGC AAGAAGGACGATCCAAACCCGGAGAAATGCCTCCA
solcap_snp_c1_8293 PGSC0003DMB000000281 257771 TCAATAACCCTCAAATTATCAACACCAATAACCTT ATAATCTTGATCAAC[A/C]ACATTACCAACTTGA CAGCCTCCATGATAATGCCAAATTGTCATAACAGT
solcap_snp_c1_8297 PGSC0003DMB000000281 204093 GATAAGGCAAAACTTGTGGAGGAAACAGGATTACA GCTGAAGCAAATCAA[T/C]AACTGGTTCATCAAT CAAAGAAAGCGCAATTGGCATAGCAACTCACAGTC
solcap_snp_c1_8300 PGSC0003DMB000000281 675845 TACCCTCAAGACGATCCAACAAGTACTTTTACTTG TCAGAGTTGGACTAC[G/A]GACTACAAGATTATG TTCTGTCCTTATGGCTCTACTCACAATGAAACAAC
solcap_snp_c1_8316 PGSC0003DMB000000519 70324 CAATAGTAAAAGACTACAACTTGAACTAAGCATCA CTTGCTTCCTGCTTC[C/T]GAGGATGATAATCAC AACCATCCCATTCTACAGCATGCACACATTCCGCC
solcap_snp_c1_8319 PGSC0003DMB000000226 151638 AACCATTCTTGCACTTAAAACTCCAAACATCTCAC AAAAACACACACTTG[A/G]GAAGACAATATGGCA CCTGAATTTCAAAAGAACGCTATGTACGTCTCAAA
solcap_snp_c1_8323 PGSC0003DMB000000226 157483 ATAAATGATCCCAAGCCTGGAGCAACAGAGACTGT GATCATTATATCTGG[T/G]ACGCCTGAGCAGACG AATGCTGCTCAGAGTCTCATTCAAGCATTTGTCAT
solcap_snp_c1_8328 PGSC0003DMB000000519 295032 GGCTTGGTTGCTGCTGGAGTCATCCCTTCTCCTTT TGAGTATGCAGATGT[T/C]GTTACCACCACAACT CACAAGTCACTTCGTGGGCCACGTGGAGCGATGAT
solcap_snp_c1_8330 PGSC0003DMB000000226 219579 GCACTCGAGTTCTTCGCTTCCTTTCCTATCACAAT CCAGCCATTGTAAAA[C/T]AATACTGACCTAGAT TCCGTTCCCGCCAGATCCAACGGTACGTCAACCTT
solcap_snp_c1_8334 PGSC0003DMB000000226 287648 TTTCCTTTTTTCTTCTTCTTTGAAAGTTCTTGTTT GAGGCTACTTAAATA[G/T]CCACTGTATTTTCTC AACAAGTGATTCTTCAGTTCTCTATCTTCTGCTCT
solcap_snp_c1_8335 PGSC0003DMB000000226 287702 TTGTAGTGCAACTCCCACCAAGTGATCAACTTCTG CCTAGCATCTTTGGG[C/T]AATTTTCCTTTTTTC TTCTTCTTTGAAAGTTCTTGTTTGAGGCTACTTAA
solcap_snp_c1_8337 PGSC0003DMB000000226 352409 GTAGGAGATGGCATGCACATTCTCTCCGCACCAAT TTGCATTCTGATCGC[A/G]TTCTGTTCAGGACGA AATAGAAATACTCGTCCATCATCTCTTCTATACGC
solcap_snp_c1_8341 PGSC0003DMB000000118 1507194 GGCATGCTAAAAGATGGACTCTGGGATGTCTATAA TGATTTTGGCATGGG[C/T]GTCTGTGCAGAACTA TGTGCTGATCAGTATAAAATTACAAGAGAAGAGCA
solcap_snp_c1_8344 PGSC0003DMB000000118 1454084 ATTCAAGTTGAATCCCCTACTTTGGCATCAATGGG TAGCCCGAATGTTAT[C/A]ATGACTTTAAAGCCA GGTAGAGGTTTTGATGCAAGGCATGGTGCCAAGAC
solcap_snp_c1_8346 PGSC0003DMB000000118 1245907 GTGTCCACAAGAAGCAAACATTGTATTTAACACAC TTAACTGCTAAGACA[C/A]TTCCAAAGGGTCTTC ATTGTCTTCCTTTACGCCTTTCAACAGAGTATTTC
solcap_snp_c1_8347 PGSC0003DMB000000118 1245863 AAGACACTTCCAAAGGGTCTTCATTGTCTTCCTTT ACGCCTTTCAACAGA[G/T]TATTTCAAGTTAAAT TCTTCCCAACAGCATTTTCCACATCAAGAGAATTT
solcap_snp_c1_8348 PGSC0003DMB000000118 1245833 CCTTTACGCCTTTCAACAGAGTATTTCAAGTTAAA TTCTTCCCAACAGCA[T/C]TTTCCACATCAAGAG AATTTAGAAAATCCCAAGCTATACCACTATGCACT
solcap_snp_c1_8353 PGSC0003DMB000000118 1566101 GTGGTAGAAAAGTGGAATTGATTTCACCTTTGCCA AAACCACCAGAAGAA[A/C]ATAAAAAAGAAGAAG AAAAGAAAGAGGAGTTGCCAAAAGTAGAAGAGAAG
solcap_snp_c1_8354 PGSC0003DMB000000118 982301 GGAGGAATTGCAATATGTGGGAAGCGTGGAACAGC TAAAACTGTAATGGC[A/G]CGTGGGTTGCATGCT ATTCTGCCACCAATTGAAGTAGTTGTTGGCTCTAT
solcap_snp_c1_8358 PGSC0003DMB000000343 479506 CAAACCAGTAAAATGAAAGACCTGAAACTGGAGCA AACACACAAATTCTC[T/C]TAATAATTCTTGAAC ATGCACATATCATTTTTTCTTCTTCGTCCCCCAGG
solcap_snp_c1_8362 PGSC0003DMB000000343 597694 ATTCTTGGTCTTGGTCTTTGTTTTTGCCATTTCTT TGGGGGTTTAAGAGA[G/T]ATTCATTTCTTGTGG TCAGAAGGGAAGAACATCAGGTTTGAAGTTTTTGA
solcap_snp_c1_8367 PGSC0003DMB000000107 469480 CAGAGCCAAAACCAAGCCTCCTTCTTCATCGCCAT TGCCATCGCCATCGC[T/C]ACTTCCACGATCAAG AATATCATAGACTTCCCTATCGAAAAATCCAGGTA
solcap_snp_c1_8368 PGSC0003DMB000000107 469536 GCATCATCCCCTGATACAGCAGCACTTTTCCCACT ATCAAACAAAACTTG[C/T]GACCCCAGAGCCAAA ACCAAGCCTCCTTCTTCATCGCCATTGCCATCGCC
solcap_snp_c1_8380 PGSC0003DMB000000147 242191 TTGTAAACCATTGACATCATTTCCCCACGATCTTC GGCACTGAAGTACAT[G/T]CCCCTCGGACGTCTG AACAATCCACTGTACTTCTGGCAAACAAGACCAAC
solcap_snp_c1_8390 PGSC0003DMB000000309 367161 TGAAACCTACAACACCAGCGGTTGCCACGAGGAGT GTGATGATGGCGAGA[T/C]GAGGCAACAAGATCA CAGCAAAGCTACCAGGGCTGAGTACCGGCTTTTAG
solcap_snp_c1_8404 PGSC0003DMB000000309 160124 TTGTTCAGGAATTCAGCTTGCTCAGGAAAGTATTC CAACAGTTCATCTTT[T/G]GTCACCCAGACAAAA TCATCACACTTTCTAATATCAAATTTGTTGACTGC
solcap_snp_c1_8405 PGSC0003DMB000000309 160100 GGAAAGTATTCCAACAGTTCATCTTTTGTCACCCA GACAAAATCATCACA[C/T]TTTCTAATATCAAAT TTGTTGACTGCAATGACTTGGGATTTGAAGAAGAA
solcap_snp_c1_8415 PGSC0003DMB000000309 679960 ATTCACATACATTAAAGACAATTATTTTAAGAATA TGTACACTTGTACAT[G/A]GATTAGAAGATTCTT GTTATTTTGGTTTTTTCTTGACATAGATTAAGCAC
solcap_snp_c1_8427 PGSC0003DMB000000012 704074 TAACTGATACGACGGCAAAGGGTAATGCCATCACC AACGGGAAGCTGGCA[G/A]ATTTCGATTCTGGGA TCAGCAGCTAAGGCCTTGTTGAGTTCCAATACGAA
solcap_snp_c1_8437 PGSC0003DMB000000012 865057 CAAGCATTCGTGCTTCAGGATAAAAACGTGGACCC TGAGCTGATTGTTGT[G/T]GCATTTAGAGGAACT GAATTCTTCAATTCTGATGATTGGATCTCCGACTT
solcap_snp_c1_8490 PGSC0003DMB000000004 572234 TCCTAAGGGGTATACACTCACCAGTTTGGATGCTT TGAAGAAGGAAGGAT[C/T]GTTAAACATCCAAGC AGGAACAGCCTTTGTGGACTTCGAATTTATTGAGG
solcap_snp_c1_8508 PGSC0003DMB000000240 577545 CTCGAAGAGGCATCTGAGAAAAATTGACTTGATGA CTGCAGACTGAAATT[T/C]GGAGATTCAGGCTGA GGTGAATTCTGGAAAAAGCCAGATGACGAATCTCG
solcap_snp_c1_8516 PGSC0003DMB000000240 375441 CACCAAACTATTGACTTTTCTAATCTTTAAGTCTT CTCAAATGTCAGTTC[C/A]ACCCCTCCACTATCT CGAAATTACAAACAAAGCCCCTAAATCTCTAACCC
solcap_snp_c1_8518 PGSC0003DMB000000240 267331 TTTGCCATCCAATGTGAATTCCGATGTGATCATCT GACACTGGCCCTAGT[C/T]GAACTGGCCACGATC TCTGTTGTTCATCCATGAGAATCATCTCAAAACGT
solcap_snp_c1_8522 PGSC0003DMB000000240 788981 GAAGTCAATCTGTTGAAAAGCTTCTTATTGCGCCC GCATATTATTAGGAC[C/T]TGACCGATTGGCTCC CCTATAGTTTCATCATACAGTGCATCTCCAAGTGC
solcap_snp_c1_8534 PGSC0003DMB000000001 5279670 TGCAACACGTCCAATTGCGGATTCACCAAAGTCTG GGTCTAGCACATCTT[T/C]AAATTCACCATTACT TCCATCAAGAGGCACAGTTCTGACTTTAAAACTCG
solcap_snp_c1_8535 PGSC0003DMB000000001 5279133 CCGTGAATACCCATCCTCCTATCAATCATGCAGGA CCCATCAGTGACCAA[G/C]AGAGTAGGAAACATG TCAAAACCATCACTTAAGCACAGGTGAAGTATCAG
solcap_snp_c1_8541 PGSC0003DMB000000001 5485835 GACATGTTTAGTGGTCCTTCTTAGCCATGGCTTTG TCTTCATCATCCTAA[T/C]GATGAGTGTTGCATC CTCATCTTAATCTCGGTGCTATCTTACCTGAGCTT
solcap_snp_c1_8549 PGSC0003DMB000000496 205170 ATGCTAGAGACTCTTCTCACAAGCATGTTAAAAGA AGCAACCATTCTCAT[A/C]GACAGGACAGGTCAA TAAGTCGAGAGCGCTCATCTGGAAGACAGGAGAGG
solcap_snp_c1_8560 PGSC0003DMB000000496 339428 CAGTCAGCTTGGCCCATATAATATCTCCGGGCTCA AGAGCTTCACAATCA[G/A]CCAAACTAGCAGCTA ATACAATCATCTCATCAACACCGATTACATCAGTT
solcap_snp_c1_8566 PGSC0003DMB000000496 363282 CATGCTGAGCAGAGAAGAGTGGAGATAGAGAAAGA AAAAATGGAGAAGGC[G/A]TCAGCAGTAGTTGCT TCATGATTTTGGTCAACCGGTTTGCTTTTGGCCAA
solcap_snp_c1_8570 PGSC0003DMB000053603 54 TGGGGCAGATGTGATCCTGGATCAAAATAGAAATT ACCCGCCTGAACTGC[G/A]AGGTACTTCAGCAGA TTAAGTGGTTTGAATGTAGCTAACCACAAAAACTC
solcap_snp_c1_8572 PGSC0003DMB000000651 71297 TTAGTTTTTCTGCTTTATTCTCAAAACCCACTACC TCCTCATCAGTCACA[A/G]GATTGCTATGTCGAG CTGGCAGATGTTTAAATGGAGCAGCCACGTAGTGA
solcap_snp_c1_8573 PGSC0003DMB000000651 122083 AAAACCCACTACCTCCTCATCAGTCACAAGATTGC TATGTCGAGCTGGCA[G/A]ATGTTTAAATGGAGC AGCCACGTAGTGAGGATTAATAGGAATGTCATCTG
solcap_snp_c1_8574 PGSC0003DMB000000864 74910 CAACATTTGCAACTTGTCATGGTGGTCCTATGGAG ATCATTCAGGACGGT[G/A]TATCCGGGTACCATA TAGATCCTTATCATCCCAATAAAGCTGCTGAGCTC
solcap_snp_c1_8575 PGSC0003DMB000000496 21772 TCACGTTTGGAAGCTAATATTGGAACTTGTAGCCA GCTGCATTCTTCAAC[C/T]TTTGTTGATCAACCA CTCTCTTCTGATCAGCTTCCTGAAAACATTGTTTT
solcap_snp_c1_8581 PGSC0003DMB000000031 1860094 CAGAGAGTAAGGCATTTGTGTCAGTCAGTAGAACA GCATCAATTCGTCTC[G/A]CTGCCATCCGCCGAC ATGCCTCGGACACGGTGGTTCCCTCCGGAATTGTC
solcap_snp_c1_8592 PGSC0003DMB000000106 522215 CCTCTATACAGTAAGCCATGATGATGAGCTTGGAA GCGATGATGAACCTT[A/G]ACTAGCCATCCTACC ATATCATTACTCATCCCTTAATAGTCAACTGTACA
solcap_snp_c1_8593 PGSC0003DMB000000015 2688782 TTGTGTGGTCCTGCAGCAAACAAGTTTTTGTTTGG AAACCATAATAAATT[G/A]GTCACAGCTTGGTGG CCAACTTCTGTGAAACAGCTGCTTGGGAAGAGTTT
solcap_snp_c1_8594 PGSC0003DMB000000245 656994 CATTCTCCCAAAATCAAATCATTGCACTCCAAAGG CTCAGATTCCTGCTT[C/T]AAATTTAAGCCTCTG GGTAATCTTAGTGATGCCAAATGGTTTACGAAATC
solcap_snp_c1_8599 PGSC0003DMB000000245 600789 GGAGTGATGATGGGTCGGTGATGGATGGTGGGGAA AGAGAGGAAGAGAGG[G/A]GTTCGAATGTGGAAG GGTCTACTTCTTCTGGGAGTGGGAATAATAGGGAT
solcap_snp_c1_8601 PGSC0003DMB000000361 512635 TTTCCACAGAGAGATCTTGTAATCTATGAAATGCA TGTTCGTGGGTTTAC[A/T]AATCATGAGTCGAGT GAAACAAAATATCCTGGTACTTACCTTGGTGTTGT
solcap_snp_c1_8601 PGSC0003DMB000000612 253657 TTTCCACAGAGAGATCTTGTAATCTATGAAATGCA TGTTCGTGGGTTTAC[A/T]AATCATGAGTCGAGT GAAACAAAATATCCTGGTACTTACCTTGGTGTTGT
solcap_snp_c1_8603 PGSC0003DMB000000245 288396 GTCATATTTGATCCACCAACAACACTTTCTGATGT TGAGAAAGTCAGAGA[A/G]TTCATTCCTGAAGAA TCAGTTCCATATGTTGGAGAAGCATTAACAATTTT
solcap_snp_c1_8606 PGSC0003DMB000000499 93097 AAGCTCATTGATCACCCTCTGCCCATCTGCAGGAA CCCCAAGTCCAGATG[T/C]ATCAAAGGAGGGTGG AGCTGGGTTGACCGGAAGCGAAGCCTGCTTTGGCT
solcap_snp_c1_8619 PGSC0003DMB000000394 8080 TCTGGTTCCAATGACAATTCTCCATGTCTTGAAAG GACTCCTGATTCTAC[G/T]CCTGATGGCTTCCAT ACACATGCTACAAAGAATTGTGTGCAACATTCTCG
solcap_snp_c1_8631 PGSC0003DMB000000155 1017845 TCAATCCCGAATCTCTGATGTTTTTGCTGTTGACA TTCATCCAGCTGCCA[A/G]AATCGGAAAAGGCAT CCTCTTTGATCATGCAACTGGAGTGGTTGTTGGTG
solcap_snp_c1_8632 PGSC0003DMB000000155 1017679 TTTGGTGGTGACCGACACCCTAAGATTGGTGATGG AGTGCTCATAGGTGC[A/C]GGTGCCACGATATTA GGCAACATAAATATTGGTGAGGGAGCCAAGATTGG
solcap_snp_c1_8635 PGSC0003DMB000000155 1016096 TCACTCTATGGAATCTTTCCTTATGCTGGGCTGAA ATTTTACTTCTATGA[G/A]ACAATGAAGAGCCAT GTCCCTAAGGAGCGGAAGAATGATATCACGATAAA
solcap_snp_c1_8641 PGSC0003DMB000000155 887720 AACACTCAAATACGCCGTGTGCGTACTCACACCCA TCACCTCTGTTACAA[T/C]TCCCTTTACGAAATT CCGGGCATGCAGTACCGGAATAGTGAAACTTCCGT
solcap_snp_c1_8642 PGSC0003DMB000000155 845170 ATTGGTGGTAATGTAACAGCTTCAGCCTCACGAGA GCATATGATCTACAC[T/A]TATGATGCTTTGAAA ACTTATGTACCACAAATGGTGGAGATGCTTGCTGA
solcap_snp_c1_8646 PGSC0003DMB000000155 748363 GCACAAGTGACAGGTGCAGTAACAGCACAAGGAAG GAGCAGTATGTTGGA[G/A]GACACTGGATTTAGT TTTGTGAACTGTAAGGTCACAGGTTCAGGTGCATT
solcap_snp_c1_8659 PGSC0003DMB000000128 412147 TAGATTTGCCTCAGGGCAAGCATCAAGGGACAGAA CTGGTCAGGCCCGAA[T/C]TCATGGTGGTCAAGG TTCACGATATCAGACAAATGCAGCTGCTAGGGGAG
solcap_snp_c1_8674 PGSC0003DMB000000128 49053 AGAGAACATCGATTGTGGTTTATGAGGGTTGCCAA CTTGGAGCCTCTTGT[T/C]AAGACCAACGCCTAT GAGAGAGGATCTTATATTTGTTTTGATCCAAACAC
solcap_snp_c1_8679 PGSC0003DMB000000128 501744 GATTACACAACTAAGCTCTCACTTCAATTGCAGTC TTTTCCGAATAGCGA[A/G]TGTCTGGTTTAACAT CTTCCCATAACTCCGGTAATGCTTCCTTCATGTTA
solcap_snp_c1_8681 PGSC0003DMB000000111 818376 CCCATTAATCTCTAATTTATTGTTATTAGTAGTTA AGTTGCACAACAAAA[T/C]GATCAGTGAAGGTTC GTGTGATTTGATCGAAAACACTACTGATGAGTCAG
solcap_snp_c1_8686 PGSC0003DMB000000666 60316 AGCTGCTTTCGGAACCAAGAAATGAACTTTGGGAG ACTAAAGAATGTGGT[G/A]GCTGCTGCAGCCATT GAAGGGGTGACTGAGGCAAGGGCCAGGATATTTGG
solcap_snp_c1_8701 PGSC0003DMB000000096 1744326 GCAAAATGCAATCTCTTATTCTTGCGAATATCATC TCTAACTCGTGGGAG[C/T]AAGACCAACTTGTAG AAGCGTTCTGCCTTCTTGACACCCAAATTTGAAGC
solcap_snp_c1_8707 PGSC0003DMB000000666 16556 TGTGTGAGAACATAGATCTTGGATATGTTACTGTT CAAGCAGTTGCTTAC[A/G]GGAATGTCAATCAGA CGATAATTTGCTCCAAGTGGAACAGCTGGCTTTGC
solcap_snp_c1_8708 PGSC0003DMB000000666 16565 GAGTTGAATTGTGTGAGAACATAGATCTTGGATAT GTTACTGTTCAAGCA[G/A]TTGCTTACAGGAATG TCAATCAGACGATAATTTGCTCCAAGTGGAACAGC
solcap_snp_c1_8709 PGSC0003DMB000000666 17213 TTCTCTGCAAATTCAATAATGCGTCCTTCTTCGTC AATCTTCATGAGACC[G/A]AATGCAGTGGCACGC TTCTCGTCCATTGGCAGTGCGGCAACGGTAATATC
solcap_snp_c1_8713 PGSC0003DMB000000666 33283 GAGTTGCATTTTGGGAAGTCAGAACTGGCACTTTC CCGGTTTAGCAGCTG[C/T]GTAATGCTTGTAGCA TATGGTGCATACCTGTTTTATCAGCTGACTAGTCA
solcap_snp_c1_8723 PGSC0003DMB000000048 301605 GTAAGGAAGATAGATCGCTCTATAAACTGTTGCAC TCGCTCCATAACCGA[C/T]TTCTTCGAGAAGCTT GTAATCATTTGGATTGGCCGAATAGTTTCTGGGAC
solcap_snp_c1_8754 PGSC0003DMB000000048 544264 GAACCATCTGGTCAGTCTTGTGTTGGTGTACTGGA GCTCATAATGACCTC[C/T]CAGAAAATCAACTAT GCCCCTGAAGTTGATAAAGTATGCAAAGCACTTGA
solcap_snp_c1_8759 PGSC0003DMB000000048 91909 TCAACCTTGTCACAGATAGGACTCAGGAACCATAC TCTGACTCACAATGG[T/G]TTAAGGGCTGTTAAC AAGCTTGATGGGCTCCAATCAAGAACTAATACTAA
solcap_snp_c1_8760 PGSC0003DMB000000048 91947 GACTCACAATGGTTTAAGGGCTGTTAACAAGCTTG ATGGGCTCCAATCAA[G/C]AACTAATACTAAGGT AACACCCAAGATGGCATCCAGAACTGAGACCAAGA
solcap_snp_c1_8761 PGSC0003DMB000000048 92005 CCCACAAAGATCAAGTTCATTCCCTTTCCACAAAC AATGGTAGCTGAGCA[T/C]CCAGGTCTCTTGGTC TCAGTTCTGGATGCCATCTTGGGTGTTACCTTAGT
solcap_snp_c1_8763 PGSC0003DMB000000048 124109 ACATTTAGCGACTATACTGTTGTTGATTATGCTTG CTTAGTCAAAATTGA[T/C]CCTCATGCCCCACTT GACAAGATGACCTTGCTTAGCTGCGGCGTATCCAC
solcap_snp_c1_8764 PGSC0003DMB000000048 124131 TTATCATTTTCTTAATACTTCAACATTTAGCGACT ATACTGTTGTTGATT[A/C]TGCTTGCTTAGTCAA AATTGATCCTCATGCCCCACTTGACAAGATGACCT
solcap_snp_c1_8765 PGSC0003DMB000000048 124228 AAACCAACTTGTGTGGCAAGTTCCGCGTCAATCCC TTCAAAAGTGTGATG[G/A]ACAGCGACGGAAAGT GCAGGTTCAGGAACAAGGATGGGATACCCATTTAT
solcap_snp_c1_8766 PGSC0003DMB000000197 582444 GAAAGGCCTATTCAATGCTGTGGAGCTTAATAGCA AATCCTTATTACCTG[T/C]GACAGCTTATGATAT ATGTATGAAACTGAAGGAGAGAGGCATTCTTGCTA
solcap_snp_c1_8769 PGSC0003DMB000000494 189779 ACTGAGAAATTTTCACTTTCATGGTTTACTGCAGT CCATGCTGCTGTTCC[C/T]TTCATAGCTATGCTG AGGAAGTCAGTTGTGATGCCCAAAACAGCTATGGC
solcap_snp_c1_8819 PGSC0003DMB000000076 978748 AATTCCTTAATAATCACTTCTACTCTTTCATACTT CTGACGTCGACTCAT[C/T]TTGCATGGAAGTCTT AAGAATGCAGCAAAAACTAAAGTTTCCTCAACCGT
solcap_snp_c1_8829 PGSC0003DMB000000076 727280 ATTGGTACTTTCAAGAAAAAGGCATTACATGCTTC AAACAAGTTCACTCA[C/T]TCTCTGAAGAAAAGA GGAAAAAGGAAAGTGGACTACAGGTTCCCTTCAGT
solcap_snp_c1_8830 PGSC0003DMB000000076 727223 AAGAAAAGAGGAAAAAGGAAAGTGGACTACAGGTT CCCTTCAGTTTCGAT[A/T]GAGGATGTACGTGAT GCAAAAGAGGAGAATGCTGTCTGTGAATTGCGTCA
solcap_snp_c1_8834 PGSC0003DMB000000076 1082166 TATACTGGATATACCACAGCATCTACTGCTGTTCA GTGGTTTTGGGAGGT[C/T]GTTAAAGGTTTTAGC AAGGAAGACATGGCAAGATTTCTTCAATTTGTGAC
solcap_snp_c1_8838 PGSC0003DMB000000273 678308 CAACTTCTTGATATATAGCATCGGACAGTTGCCTC AGTTTCATATTTTCT[G/A]CACCTGGACGGTTAA GTGCTGCTGATTCTTTCACTGTAGCTCTTAAGCTA
solcap_snp_c1_8854 PGSC0003DMB000000273 384925 TTGAAGTTGAAGAGGTAGCAATTTGGCAAAATATA CATTCCGATAAAGCT[C/A]CTCCGGTCATTCTTC CGACCTCCGTCACTGTTCGGATCATATCACCATTG
solcap_snp_c1_8861 PGSC0003DMB000000134 968904 GTAGAACACTGCTTGGTGCTCTGTCCCTCCAATTT GCCTGGCTTTGAGAT[G/A]CCAATGGTGGATAAA ACCATACAAGGTGGTCTAAATTCCATATCTATTGG
solcap_snp_c1_8867 PGSC0003DMB000000091 313775 TTCTCCCGGTTGCGGATGTGTCACATCAGCACCAA AGACAATTGTGGGCG[T/A]ATCAGTGATGAAAGG CATTCGTTTAGTAACTGCCAGCTCCAAAACAGAGT
solcap_snp_c1_8883 PGSC0003DMB000000091 505663 CCTTTCTATCCCAGAGAAAAGCTTGTTGAGAAGCA AAAGTTTTACCAAAG[T/C]GTCCACAAGCACACA TACTTGAAAGGTCGTTTTGACAAGATCACCTCAGT
solcap_snp_c1_8908 PGSC0003DMB000000467 28188 CCATAGCTGTTAACACGAGCCTTCACCGTGGTCAA TGGGTCCAACAAATG[C/T]TGTGTCCCAATGGTG AGTGTGTTCTCATTGCTTGAGAAGCTGTGAGTCAA
solcap_snp_c1_8913 PGSC0003DMB000000014 3179575 CTGCTGGAGCTGCTCCTCCACCTGCCATTTTTTCC TCACTACAACTCAAG[G/A]GATACTCAACTGTTT AACAGTAACACAAAATTTACCCAACTTTCCACTTT
solcap_snp_c1_8914 PGSC0003DMB000000186 134800 TTGACATGTTTACTTGTTTATCATTACACTTGCAA TCCACACACCAGTTG[T/C]ATTTTATTAACTTAA CCAGAAGATAGTCTCAGCAATAAGTATCAGATGAC
solcap_snp_c1_8944 PGSC0003DMB000000384 454448 CAGTATTTTCTGTCTCCTTCTCTAATGGCGCATGG AGGTTATGGGAAACG[C/A]AGAGTCCCTGAAGCT AATAGTAATAGAAACCGGCGACCCAAATCATTAGG
solcap_snp_c1_8968 PGSC0003DMB000000453 373421 TGCTGGCACCTATGTTTTGCAAAGCCATCTTTGAT TCAGTAAGAAATTTC[T/C]GGATGAAGTGTTAGG TATGTTCAGAGAATTCTTCAGCAGAACAATTGCAA
solcap_snp_c1_8969 PGSC0003DMB000000453 373531 TGTGCCTTCCAGCAACCAGAATAGTCGTAATGCTC TTCCTTTAATGGTTC[G/A]AGATGCATACGGTCA ACCCGACCTGAGAAATGACGGTTCTTTTTCTTTGA
solcap_snp_c1_8970 PGSC0003DMB000000453 373542 GCAACCAGAATAGTCGTAATGCTCTTCCTTTAATG GTTCGAGATGCATAC[G/A]GTCAACCCGACCTGA GAAATGACGGTTCTTTTTCTTTGACGTAGGACAAT
solcap_snp_c1_8972 PGSC0003DMB000000453 393706 TACTGATCGATCGTCGTCGGAGATCAAGTCAGTTG CTGCCAATGTTCGCG[C/T]CGGCGCGACGTCGGA ATCTTCAGGAAGGAGTCTCATTCCGACCATATATA
solcap_snp_c1_8974 PGSC0003DMB000000453 146737 AATTCACGATTCTCCCAATCTGCTTGTACTGCTAT GCCTACATTCACCGC[A/G]TTTGTTATTCCTCCG GCTCGAGCCATTTCTGGTCACTGCTTTCCGATCAA
solcap_snp_c1_8982 PGSC0003DMB000000785 118410 TGCTTGAATGCTGCAGCAAAAATATCCCACAGAGC CCAAGGTATTGGATC[A/C]ATAGCGAGTAGGTGG CATGCTTTGGCTACATGCACTTCTGGTGAAGCGTC
solcap_snp_c1_8997 PGSC0003DMB000000093 1257890 CCTTTCCCGGAAAAGGAACAACAGAAAGGTTCTGT TTCACAAACTGAGCA[G/A]GCAATACCTGAAACA AGACGCAGTAATACACCTCTCCTCTTCTTTGGGGG
solcap_snp_c1_8998 PGSC0003DMB000000093 1257876 GGAACAACAGAAAGGTTCTGTTTCACAAACTGAGC AGGCAATACCTGAAA[C/A]AAGACGCAGTAATAC ACCTCTCCTCTTCTTTGGGGGACTCGGCAACAAGT
solcap_snp_c1_8999 PGSC0003DMB000000093 1255101 GCACGAATAGACAACTTGGAGGTTTTTGTTCCTTG AGAGTTTGATTTCCT[C/T]TGAATAGTCACCATA GGTGTCTTGACAAACGAGGAGGACTTTGCAGACCA
solcap_snp_c1_9014 PGSC0003DMB000000093 999875 AACCACGAATGCAAATTTCACCGGGTTGGTTGCGG TCAAGGGAGCCACCG[T/G]TTTCCGGGTCAACCA CCTTGAGGTCCGCATTTCGAACCACAGAGCCACAT
solcap_snp_c1_9025 PGSC0003DMB000000093 850244 GAGAACCATATCAAAGATAAGAGAATTGTACAGCA AATTGTATCGACCTG[G/A]AATTTGATAGTGTAC ACATATGCTTATAACCACAGGTTCAATACGAGGAC
solcap_snp_c1_9027 PGSC0003DMB000000008 3100269 GATGCAGTCCAAGATGATTTGAAGCGTGCCACTGG AGAATTTGTAAAAGA[T/C]GAGACTGATGCTAAT AAACTAAACCGGGTTCTGCAACTAACAGGATTTAG
solcap_snp_c1_9056 PGSC0003DMB000000008 3178020 GCTATTCCAAAGCTAAACCCATCCGATCTCTGCAC TTTTGCGTCGGCACA[T/C]GGTGAGTACACATGG TTCGTGTCGCTGCGCGATTGTGCTAAAAGGGTCAG
solcap_snp_c1_9058 PGSC0003DMB000000008 3285212 AAATCCCTTCAGGAATGTGTAACTTCATTCGGAAC ATGTCATGCTGACAA[A/G]CAGGGGAAACAATAT CGTGTTTGGGTCGATCAAGTTTTACCTTCACAGGT
solcap_snp_c1_9059 PGSC0003DMB000000008 3293551 TTGTCCAAAATGATACTTGTGACATTTGCCCTATA AAGTATCTGACTTCC[G/A]TGATCATCCAATCCT TTTGCTAAGGATTTGGCGATCTCGCCAACTCCACC
solcap_snp_c1_9060 PGSC0003DMB000000008 3294499 AAATGGTGGCAATCAGTGTCTGGTGGGAGTACATC TGCTTTAACCCCCAT[A/G]TGAATAGAAAGAAAC GAAGGTGCTTTTACATAAGCTTTCTGGAAATTTTC
solcap_snp_c1_9075 PGSC0003DMB000000189 601842 TCAAATGGAGACATGTTTGAGAAGAATCATGATGA AATTGACTTTGAGTT[C/T]TTGGGAAATATTAGA GCAAAAAATTGGAGAATTCAAACTAATATTTATGG
solcap_snp_c1_9083 PGSC0003DMB000000189 975137 GAGTCGCCGGTGAAGAAGTGGAGTTGTGGGGTCGG AAGAAATCATACTTG[G/A]TGGCTCAGTTGCCAT TTTTCTTGAATGTTCAATATGGATAAAAATTCAAT
solcap_snp_c1_9084 PGSC0003DMB000000189 975141 TTTCGAGTCGCCGGTGAAGAAGTGGAGTTGTGGGG TCGGAAGAAATCATA[C/T]TTGGTGGCTCAGTTG CCATTTTTCTTGAATGTTCAATATGGATAAAAATT
solcap_snp_c1_9103 PGSC0003DMB000000147 1140261 GGAGATAGAGTCACATTTGATCCAGAAAGAATAGT TATGAGTGGAGGAGC[C/A]ACAGGGGCTCATGAA AGTTTGGCCTTTTGTTTGGCTGATCCTGGTGATGC
solcap_snp_c1_9111 PGSC0003DMB000000006 1745106 AACTCATTCACACCAAATTCAAACTTATTTGCAAT ACGCTCCAAGTGCTC[C/A]ACTGCTATCCGAGAA GCCATTTCATATCCTTCTGCAACTCGAATAGGGTG
solcap_snp_c1_9120 PGSC0003DMB000000642 99503 CAAAGCTAGCTAGGGATCTATACACACTACATCTC CGTCATCTAGGAGGC[C/A]TTCATCAGAATCACA AGTACTTCCACAAGTAGATTGCACTTTTTGAAGAA
solcap_snp_c1_9129 PGSC0003DMB000000013 188340 TGGTTCTCCAAGCTTCCCTTTGGCATGAATTCATA TACAAGTAACAGTTC[C/T]TTGTCTTCCCAACAA TATCCCAGCAATTTAACAAGGTTTGGGTGTGAAAG
solcap_snp_c1_9141 PGSC0003DMB000000154 700047 GTTTTACTGTATCAGGACATCGATTATCGGGCGTG GATTCAAACCTTCCC[G/A]GCTCTCTAGTTTCAA GGAACCGAGAAACTTGCTTCATAGAGCGGAAAGTT
solcap_snp_c1_9144 PGSC0003DMB000000154 536450 GGACGGGTTAAAAAAGTTGGAAGTGCTCAACATAT CTCATTGCGTAATTA[C/T]TGAAGATCCTCCACC TGCACCAAAGAAAATTCTGGCCAAGCTTGATGATT
solcap_snp_c1_9153 PGSC0003DMB000000154 327037 GGTCCCACTGATAATATATCAACTTTACCAACAGC TTTTTTCAATTTCTT[C/T]ACCACTGCTACTGCA TCCATCTCTCCTATCACTGTTAATTTTTGCTCCTT
solcap_snp_c1_9161 PGSC0003DMB000000154 246793 CCTACAATTCACCAAATTCTGTTGGATCGTCACCT CAGCAAACCCGAATC[T/C]GAATACCCGAAGCTC CGATTCATTCGGAGCTGCAGTGCAGCACTGGCTCC
solcap_snp_c1_9167 PGSC0003DMB000000364 117109 CTGTCAAGGAATGTCTCACGATTGACTGGTGACCA TTTTGGAAACTGATC[G/A]AGAAGCCAGGACAAG GCAAACCAAACCTCACAAATAACTGATACTAGCCA
solcap_snp_c1_9170 PGSC0003DMB000000364 44720 TTCTTTAGTCTCTTTTGAGCAGACCAGTTACTTTG CATCACATGAACTGG[C/T]GTTTCCACCTTAGCA TCTGGCTTCGCAGCATCACTCATCTCGATGGGAAC
solcap_snp_c1_9174 PGSC0003DMB000000162 66249 TCTCCCTCTTCCACTTTCTCTCTCTATCTCAGCTA AGACATTGAAGAAGA[C/A]GAAGAACAGCAGCCA AGCAGAAGAATTCTCATATCTTTTTGCTTTGTATT
solcap_snp_c1_9183 PGSC0003DMB000000017 1699863 CGGCCTCTGCTCATCAATAGGGAACGGGAACTCGC ACCGTGGGAGGCCCT[G/A]ACTTCATATCCTCCA AGAGAAGATTTAGCAGAGCTTGTGTCACAGGACCT
solcap_snp_c1_9194 PGSC0003DMB000000017 1802301 CTAGATTTGCAAAATGTGGTTGATAGAAAGGAAGC TGTGAAGGCAAAGAT[A/G]AGGGAGAAGAATCAT GTTGAGAAGTTATCATTGGAGTGGAGTCGTAGTAG
solcap_snp_c1_9204 PGSC0003DMB000000017 1737714 CGAGTATAATAACGAAAACGATCTGAGATCATTTC AGAAAGCAGCCCAGC[T/C]CCTCTACATTAAAGC TAATGAAACCAAGTTATTTTTGCCTTGTATTCTCC
solcap_snp_c1_9215 PGSC0003DMB000000302 74319 AATTTACAGTTAGGCTTGGATCTCCTTCAGGCTAT TAAGAAAGAGATCGG[T/C]CTCCTCCCTTCACGA CAAAGTCTTGATTTCCTCCTCAGTGCTTGTGTCAA
solcap_snp_c1_9219 PGSC0003DMB000000591 167998 GAAGAGATGTGAGACTCCTCCAAACAGCTAACTTG GAGGAGGTTTTGAGT[G/T]CCTCCTTTCAAGTTC TTAACGGAAAAAGACCCAAGCAAAAAGTGCAGCTT
solcap_snp_c1_9219 PGSC0003DMB000006498 61 GAAGAGATGTGAGACTCCTCCAAACAGCTAACTTG GAGGAGGTTTTGAGT[G/T]CCTCCTTTCAAGTTC TTAACGGAAAAAGACCCAAGCAAAAAGTGCAGCTT
solcap_snp_c1_9220 PGSC0003DMB000000591 22723 TGTTTATACAAAAGGAAAAACTCTAATAGAGTGTC TTCACCAGTAAAGCT[G/A]TATTGTGGGTTTCAT TGTGGACGTGGTAGTGGTGGTGGATTGGATTTTGC
solcap_snp_c1_9224 PGSC0003DMB000000208 766038 TTGCTTTGCTTCAAGAAGGATAGCAGAGTACGGCG CAACATCATAAGTTT[C/T]ACTGATACCAGACAC TCCCTCAGTAACAAAATCATCTGGTGATTTCAGAT
solcap_snp_c1_9229 PGSC0003DMB000000208 736173 ACCAACCTAGGTTGGAACGCCTCCTCCGATGTACA AAACTTCAGAATCCG[G/T]TGGTCAGAGGAGAAG AGCCTGAGACTATCACGCCGGCGAAGCTGCCGGAG
solcap_snp_c1_9250 PGSC0003DMB000000208 506423 GTAGCTGCCACTTTTGATCCATCCATGGTATCTTC AAGAAAGAGATCAAT[C/T]GGTAGCCAGAGAACT GATGTACTAGCATCATCAAACCGACTAGCAGAAAG
solcap_snp_c1_9268 PGSC0003DMB000000268 346485 GAAAAAGAAGAAGAGAGGAAGAAGAGAGAGGAGGA AGAGGAGTATCAAGC[C/T]GGTAATGAAATTAGA GAGATGTATGTGGAAACTACAGATTCTGAGGCGGA
solcap_snp_c1_9292 PGSC0003DMB000000268 217010 TGCACCCCAAAAGCTCTTTCAAGGAATCTGTCAAC AATGGATACAAATTC[G/A]TCAACCTTCTCTTCA TGGGGCAAGTGGCCACAATTCTTGATTATTTCAAG
solcap_snp_c1_9307 PGSC0003DMB000000241 594934 CCCAAAAGCTGAAAATTGGCAAAATTTGGACTTAA AAGAATCCAATTTAA[T/C]CGAAGTAGTAGCAGC AGTCCCCAAAGGGACTAAATTGAGAATTCTTGGAC
solcap_snp_c1_9356 PGSC0003DMB000000241 950305 CAGGTGTCTCTTCCTATAAAATATGTGAAAGAATG GAAACTGCTAAAAGT[G/A]AAAGAAAAATAGAGA AGGATAGATCAAAGGAATCTGGAAAAGAATATTTC
solcap_snp_c1_9363 PGSC0003DMB000000241 977906 TGTTCTGCCATAAGGAAGATCCATGAGCATAGAAG GAGAAGGGCTTTTTT[T/C]CTGGGTTTTAGTCAA TCCCCTGTTGAGTTTATTAATGCACTTCTAGAATC
solcap_snp_c1_9369 PGSC0003DMB000000241 1005345 GTACCTTCACACTTTAGAGGTTCATCCATGTTTAA AAAACTTGTCAAAAC[T/C]GACGCCAAATTCAAA TGTCCTTCATGGGGCTGTTGAGCTTGCTTTTCAGC
solcap_snp_c1_9374 PGSC0003DMB000000528 317334 AGGAACTTGTAAGAAAATAACATCAGGCAGCAAAG ACAGGCCTCATTCAA[T/G]TCCATTAAATTCAGA CTGTAGCCAAGTTCATCAATCAATTCACCAAACCA
solcap_snp_c1_9378 PGSC0003DMB000000001 2307309 CGAGAAGAAACTGAACAAGAGTTCTTGGAGAGGTG TGCCAAGACAGCCGC[G/A]GAAATGGAAAATGGA ACCATTGTGGAAGAAGGTGATGCGGAAGATCAAGA
solcap_snp_c1_9385 PGSC0003DMB000000488 80077 AGAATTTGCTTCCGGATGCAGCTCATAGTCTATGT TACCCTCTTCACTGA[C/T]GCTGATAGCCGCTTC TGAAACTTCATGATCAGACACCTTATCTTGATTAG
solcap_snp_c1_9386 PGSC0003DMB000000488 192380 TTGCCTCCCGTATACACTGGGAGGTGGGCCAGTGC TACAGAGCAGGAAGT[T/G]CTAGAAGAGCTGGCA AAGGGGACCCCATACACATATCGGTTTCGAGTACC
solcap_snp_c1_9392 PGSC0003DMB000000488 229035 GGATTGTTGGAAGGAAACCTGTAAGGGATGGTACA TGCCCGGTAATTGCA[A/G]GTCATCAGCAACGGA AAAGGCACCAATTCCCCGGAGCTCTCCATTCTCTG
solcap_snp_c1_9397 PGSC0003DMB000000488 254459 TGTGGTGGCGGTGAATTGTTTGACCGCATCATTCA AAGAGGACACTACAC[T/C]GAGAGAAAGGCTGCC GATTTGACTAAAATTATTGTGGGTGTTGTTGAGGC
solcap_snp_c1_9398 PGSC0003DMB000000488 254513 TCCATCAAGGGTGCTTATGAGGATCCTTTGTATGT TCATATTGTCATGGA[A/G]CTTTGTGGTGGCGGT GAATTGTTTGACCGCATCATTCAAAGAGGACACTA
solcap_snp_c1_9406 PGSC0003DMB000000488 316564 ATGCTTCAGTCGGCCGAAACTGGTCTAAATATGCT GAAGAAAAGGAGTGC[A/T]TTCTTGATACAGCTG GCTGCTAAAACTGTTCCCAGGCCTTTGCATTGTCT
solcap_snp_c1_9411 PGSC0003DMB000000488 369672 AAGTGAATGTGGGTGAACAAATCAAAGTGACGTGC GTACGATTCAATGTA[C/T]TCAAGCACCATTTGT TGGTCAGGAAACACTTGGGTTACTGAATCGGGCCA
solcap_snp_c1_9413 PGSC0003DMB000000488 369804 TGTATCTGTGGGGATATGGTTCGAGTGTCCTGTAC AGTGACGTTCCACTT[T/C]CCTTTTCCGCCCCAC AAATTCCATTCTCCGTCTCCACTAATTGATGAGTC
solcap_snp_c1_9416 PGSC0003DMB000000500 370275 TGGGGATTCCCAATGGCAAAACTCTATTTGAATAG ATTCTCAGAACTTAC[G/A]GTGCATAAACCCGGT GAAGGCCTTCTTTTATATCTCATTGCTACGATTCT
solcap_snp_c1_9428 PGSC0003DMB000000500 260559 ACCCATGTCAGCAATACTGCTGAGATACGTGGCTT CAAAATCATATCAGA[A/G]CAGGGCATTGCATCA GGAATAAGGCGAATTGAAGCTGTAGCCGGAGATGC
solcap_snp_c1_9430 PGSC0003DMB000000500 239993 GTGTTAACGGCATTATTTGCATTCCATAGCCAAGA TGTTTCGCGATCTGT[A/G]TTAGCTTTAATAAGT ATTTTTGTGATAATAAATGCGGTGAGCTCATTCCA
solcap_snp_c1_9434 PGSC0003DMB000000500 182765 TAGATTAATGGAACAGTCTCACTCAGTATCAGGAT CATGATCAATCATTC[G/A]ATACCACGGAGGATG AACTAGAGAAAATGTGTGCTACTTATTTAAGGTTT
solcap_snp_c1_9476 PGSC0003DMB000000013 2042599 GCACGACAGGAGACATCAGCTTTATTAGACCAAAA TATGGCACTTCGTTT[G/A]GTGCACATATCGTTT TCCAAAAGCAACATATCATCAAAAGTGATGCTAAT
solcap_snp_c1_9477 PGSC0003DMB000000013 1629419 AAAGAGTACACTGCCAAAAATGTGCACAATCTTCT AGTTTCTATCGGACA[A/G]GAAAACGCGTTACAT ATTATAGACCAACTTCTACACATTATCATTCACAT
solcap_snp_c1_9478 PGSC0003DMB000000139 522412 TCCAATTTGGAAAGAAGCAATGGTATTGACTTGAA ACGTTTCTGGAGAGT[A/C]AATGCAGCCAAAACA GTTGTATATGTGACAAGAGTTGGCCGATGTCCATC
solcap_snp_c1_9490 PGSC0003DMB000000080 1898405 GCTAATCCTAGATCACCAATTTTGACTTGGCCAAG ATGTCCATTCACAAA[G/T]ATGTTGTCGCACTTG AGATCTCGATGTATAACTGGAGGATCATGACAGTG
solcap_snp_c1_9491 PGSC0003DMB000000106 1177891 CTTATCCGTGATGGTCGTATGGAGAAGTTCTACTG GGCACCAACTAGGGA[G/A]GATAGAATTGGTGTT TGCAAGGGTATTTTCAGAACTGACAACGTGCCTGA
solcap_snp_c1_9492 PGSC0003DMB000000106 1177663 AGGAAAGGAAACATGTGTTGTCTCTTCATCAACGA TCTCGATGCAGGAGC[T/G]GGTAGAATGGGTGGA ACTACCCAATACACCGTCAACAACCAGATGGTGAA
solcap_snp_c1_9499 PGSC0003DMB000000168 393840 GTGAAACTGGTTGTGTTTGATAAGACAGGAACACT GACAGTTGGGAAACC[C/A]TCTGTTGTCAGTGCT GTGCTATTTTCTAACATCTCCATGAAGGACTTCTG
solcap_snp_c1_9546 PGSC0003DMB000000330 506898 TTAAACCTGGCAACGTTCATGCCAGCACGGAGAAG CTTCTCCAGCATTGG[C/T]ACTGTTCTAGAAGAT GGCCCTAACGTGCAAACAATCTTGGTCTTTGGAAT
solcap_snp_c1_9565 PGSC0003DMB000000010 2296375 GCTCTCATTGTCACTCTCCTCTCCATGCTCGTGTA CGATGGCATAGTCAA[A/T]ACCATTTTGTAGCCT TTCATTGCTGCCATAAATGCCATACTAATCCCCAT
solcap_snp_c1_9566 NM NM AGGATTAAATCGGCTCCAAATGCTCTCATTGTCAC TCTCCTCTCCATGCT[C/T]GTGTACGATGGCATA GTCAAAACCATTTTGTAGCCTTTCATTGCTGCCAT
solcap_snp_c1_9573 PGSC0003DMB000000010 2480381 AGTCGAATTTTGCGTTTGTTAATGCGATTGAGGTT ATTTCTGCTCCTAAT[G/T]ATTTGATTGCTGATG TGGCTCAGCATGTTAGTTTTGATAAAAATGAGCAA
solcap_snp_c1_9581 PGSC0003DMB000000010 2515427 TCTATGCATTTATTTTTGTGAAAATAATGAATTTA CAGTTTTTTGAGAGA[G/T]ATAGATGTACCTGAG CTGAAAACATGAATTTCGGTTAGATCTATGCATGT
solcap_snp_c1_9583 PGSC0003DMB000000010 2516414 CTCTTGAGTCTCCCTGCTAAGGTCTGCTCAAATGA ATTCAACAGAGCAAG[G/A]AGTTTAGGAGACAAA TATGAGCCCTTGGGTGATAATATCATTTTAAACGG
solcap_snp_c1_9584 PGSC0003DMB000000010 2516444 AGGATATCTTCCTTGCCTCCAGGTTTAAGACTCTT GAGTCTCCCTGCTAA[G/T]GTCTGCTCAAATGAA TTCAACAGAGCAAGGAGTTTAGGAGACAAATATGA
solcap_snp_c1_9585 PGSC0003DMB000000010 2516471 CTGTTGAATTCATTTGAGCAGACCTTAGCAGGGAG ACTCAAGAGTCTTAA[A/G]CCTGGAGGCAAGGAA GATATCCTTAGCCTTTCATGGATGAAACAAGCAAT
solcap_snp_c1_9587 PGSC0003DMB000000010 2516889 GCTACATATGAAAACAGTTGCAACCCTCACTCCAT ACATCGCATGCATCA[G/A]AACCTTCCCTTTAGC AGAATTCTTAATCTTGGGTAGGTTCAGTGATTCAG
solcap_snp_c1_9601 PGSC0003DMB000000088 213088 ACAAAAGGGGAGGCTTCTTATTATTATACCCCCAT TTATTTATGAAAGCA[C/A]ATACAAATAGAATGA TAAAAGATTAGTGTTTGTTTAATTACATTATCATG
solcap_snp_c1_9603 PGSC0003DMB000000002 2172571 ATGAAGAGGTCACGAAATATTCTCTTCAGATAAGC ATAATCTGGTTTATC[C/T]TCAAAGCGTAGTGAA CGACAATAATGGAAATAGGATGCAAATTCATTAGG
solcap_snp_c1_9613 PGSC0003DMB000000381 247850 GAAATTGTGCCACCAAGGGACAGTGAGAGCACATT TACACCATCTATGAC[A/G]GCCTGGTCCATCCCT GCAAGTATGTCGCTGCTAAAACATCCTCCGGTCCA
solcap_snp_c1_9614 PGSC0003DMB000000381 247832 GACAGTGAGAGCACATTTACACCATCTATGACAGC CTGGTCCATCCCTGC[A/C]AGTATGTCGCTGCTA AAACATCCTCCGGTCCAACATACCTTGTATGCAGC
solcap_snp_c1_9619 PGSC0003DMB000000381 202377 GGGAAACAACCATCAGCCCAGACTCTGATATGTGA ATCATTTCTTGAGAT[G/T]AGGGAAACATGCATT GACATCAGATTTGGGATGTTTCGCCTCAGCGTGTT
solcap_snp_c1_9623 PGSC0003DMB000000381 144112 TAGATTCGGATTTGTTAGAGAACTGGTTTGGCATA TCCCACGCGCCGCCG[A/C]AACGGAAGGAATCAT CGAACCAAGGCGGAGTTAAAATCCCGGCGAAAACC
solcap_snp_c1_9646 PGSC0003DMB000000056 931058 TCACCACTTTTGGTGGAGTGATATCTCAGCAGTTC AGCAAACTTAGACCT[G/A]TTCTGTGAATCCTCA TGGATACCAAGCTTGAGGTTCTTTGAGAAGGCCTC
solcap_snp_c1_9651 PGSC0003DMB000000021 2186782 GGGTAAACCATATTGACTTCAATGTTGTTCAGTCT CAGTACAGCACTAAG[C/T]TCGAGACCGATGTAC CCTCCCCCAACAATAACAGCTTTACCATTTTTCTT
solcap_snp_c1_9652 PGSC0003DMB000000021 2233467 TGTAGAGCGACAGCGATGCCCACCCGGGACGAAAG ATAGGCATCATTACG[T/C]GATGAAAACAGCATG ACACCACCACGGCCAACATAGTGTTGTGGAGAAAG
solcap_snp_c1_9655 PGSC0003DMB000000454 304202 CCAGGCATCATACCCTTCAACCCGCAGAAATAGAT GTGGGCCCCTTCATC[C/T]AGAAGTTTGAAGATC TCATCGCTGTATTCCTCAATTTTATCCTGAACATA
solcap_snp_c1_9660 PGSC0003DMB000000454 121549 TTGGTACAGATAATGCGAGAAAGATTGCTGGTACA CCTTCGGAGTTTGCC[A/G]CAGATTGTTGAAAGT TTGAATAGGCAGGAAGATACTGACTCACAGCCAAG
solcap_snp_c1_9676 PGSC0003DMB000000104 35113 GACCGTGACCTCAGAAAAATGCTTATAAAACCCAA AGCACAAGATCCCTT[T/C]GTTACGGGTGTGCGA GTATGGCCACAAGCTATCCCACAGTTTTTGGTCGG
solcap_snp_c1_9679 PGSC0003DMB000000104 166611 TACACCCACAAGTAGGAGCTCGAGTGCAGAGGTGA AGTTAGTAGCAATAT[G/A]CTGCTTCACCTTTTC AGGCAACTGTGTTTTTCCCTCTTTCTTTTCCAATT
solcap_snp_c1_9691 PGSC0003DMB000000085 107282 TCCCTGCTGGTGTTCCTAGAAAACCAGGCATGACA AGAGATGATCTTTTC[A/T]ACATAAATGCAGGAA TTGTGAAGACTTTATGTGAAGGAATTGCCAAGTGC
solcap_snp_c1_9695 PGSC0003DMB000000490 25700 GCAGTTCCTTTCTCGAAGCACGAAATGTAAGTTCC ACTCTCCCCCTCACC[A/C]CAAACCCTACAAAAA AAAAAGAATGACAACTAAACCTTATTGTAGGCATA
solcap_snp_c1_9696 PGSC0003DMB000000490 26158 TTTGGAGAAGGAAAAGGTACAAGTAAACGACCAAC TCCATAAACGGCCAC[A/T]GCAAAGAAATGGAGT ACCAAGCTCATTGGATTAGGATTAAGACCAGAGAG
solcap_snp_c1_9701 PGSC0003DMB000000490 97733 TAGATTACTGACTAAAGCACAGATTGATGCGGACT TAGAGCAAATGAAGA[G/A]CATGAGTGCAGAGGA GGCTGCTGCAGCCGCTGCACAAGCAGTTGCAGAGG
solcap_snp_c1_9717 PGSC0003DMB000000490 174389 ACCATTGTGGTTGTTGCAGTTCCTGAGGGACTTCC CCTGGCTGTGACCTT[A/G]AGCCTTGCTTTTGCC ATGAAAAAGATGATGAATGATAAAGCACTTGTCCG
solcap_snp_c1_9719 PGSC0003DMB000000490 174632 TCTGCACTTTGTTCTGAAATGCCAAATTCTGTGCT CAAAACTTTGCTGCA[A/G]TCGATTTTTAACAAC ACAAGTGGAGAAGTTGTAGTTACCAAGGGCAAGAA
solcap_snp_c1_9724 PGSC0003DMB000000490 175124 CCAGTGACCATCCGAACAGTCACGCCTGCTGAACG ACAAAGTGCAACAGA[C/T]TCCTTGACTCCAGGA CGAACGGGATCCTTTATACCTACAATTCCTATGCA
solcap_snp_c1_9728 PGSC0003DMB000000490 176870 AATGTCCCTAGGTATTCGATGATTATGATTTGGAA GAAGAGAGTTACACC[G/A]ATAACTGTCACAAAT ACATAGTTATCCAGTAGGCCTTCCCAAACCTCAAT
solcap_snp_c1_9769 PGSC0003DMB000000164 751439 GATCATCCTTCAAACCTTTTGTCGTTAAGTTCCTC CTCTTAAGCTCTTCC[C/T]TTAATTCTGCTACTT TCCATTTATTAATTGGACGATTATCAAGCACAGGG
solcap_snp_c1_9771 PGSC0003DMB000000164 755401 TTCATAATCTGAACATTCAGAAGTTTCTTCAACCC AAAGCAAAATACAGT[T/G]AAGACTTGCACCTAG CAGCAACCAAAGTCTGCAAGCAGTAACAAACCGAA
solcap_snp_c1_9776 PGSC0003DMB000000402 83051 CAAGTCCTGATGGGAGTTTTCATTTGCAGAACGGA AAGAATCCAGAACGA[G/A]GGAACTATTCTCAGA AGGCAAGGCAAACGAGCTTCTTGGACTGAAGCAAG
solcap_snp_c1_9777 PGSC0003DMB000000402 83159 TGGAGGGTACATTGAGCTACTACTAGTACTTGCTT GAGTAGTAAAACTTG[A/G]TGTAGGTAAGAGTAG TTCCGCCTGAGGGCAGTAGCTATTGGATGGCACGT
solcap_snp_c1_9779 PGSC0003DMB000000402 118746 TTTGATCTCTTTGATCTGAAGCAAAGAGGAGTCGT TGATTTTGAGGATTT[C/T]GTTATGGCAATGAAT GTTTTTCACCCAAATGCCTCCCAGGAAGATAAGCT
solcap_snp_c1_9785 PGSC0003DMB000000402 231533 CGCCTCCACTTTACCTTTCTTTGTTGCTGCAACTA AAACTTGACCAAACC[T/G]GGAAAGAGGATTTCC ACTAGACTTGAAGTGTCTGTACCTAGCAGTGCCTC
solcap_snp_c1_9786 PGSC0003DMB000000402 272505 ATGATTGCTGGGAATCGACATATGCCTATTGAAAA TTTAAGACTTGTTCT[G/A]CGAGGAAATGTATTG CATGATAGTGAAAATGGAGATGACGAAGTAGTCCA
solcap_snp_c1_9791 PGSC0003DMB000000402 14460 TAACAAACTTGGGTCCTCAGCATCATCATCCAAAA GGTCGAATGGGTTCA[C/A]AGTAGCCATTTTTTT CACTCTTTCGAGTTACTAAACAGATATATATAAAA
solcap_snp_c1_9799 PGSC0003DMB000000267 569438 ACAATATCTTCTCCAGACTTGGAGAGGTGCTGCTA TTCTTTCATTTGTCT[G/T]GTTTCTACAACGATG GAAAACAAATGTGATCAGCAGAGCTTTGGCTGTAA
solcap_snp_c1_9816 PGSC0003DMB000000267 872870 CTCAATTTGAAATCCTGCGTGAATTAAAAATCAAA AGAGTTGACAGTGAA[T/A]TGCCATTGTTGAACT TGTGCAGCAACTTAACATCTCTTGTGGATCTTTTT
solcap_snp_c1_9816 PGSC0003DMB000000165 1230172 CTCAATTTGAAATCCTGCGTGAATTAAAAATCAAA AGAGTTGACAGTGAA[T/A]TGCCATTGTTGAACT TGTGCAGCAACTTAACATCTCTTGTGGATCTTTTT
solcap_snp_c1_9825 PGSC0003DMB000000248 486248 TCGCAAATGTCAACAACAGACACGCTGATAACAGA TACAGGCACCATAAA[C/T]CTCTCATATCATTAG TCCTCTGCACGAGAGTATCGCAGCTTTACTCCTGT
solcap_snp_c1_9834 PGSC0003DMB000000470 371783 GGATCATCTAAGGAAATAGCAACTATTTTCCAGTC AAGTTCTCCTTCATC[A/G]ATCATTGCCAAAGCA GCTAAAGGTTTGACCTTCAAGACCTGGCCAATTTT
solcap_snp_c1_9837 PGSC0003DMB000000179 893872 GCATCTCTATTTCTTCCATTTTCAGAAAAATGCTC ACTGAGACGATCAGC[C/T]TCAATGTATCCCACT GCAGAGGCCTCAAAAATCAACAAACTCATGCCACG
solcap_snp_c1_9839 PGSC0003DMB000000179 894450 CCTGGACCACCTTTGCATGCAGGGCAGTGCCACTG TCGTTCAGGATCATT[G/T]ATCTCAGTAACAGTC AAACTGTCAAGAGAGTCAAAAAGTTGATTGAACCA
solcap_snp_c1_9846 PGSC0003DMB000000600 157814 ACCTGTGGATTCCAGTGGATAATGTTGTATAACCC AAGAGCACTAATGCA[G/A]AGTAACCAGGTCATC ACAATTGGTGCAAAAACAAAACCAACTCGATGTGT
solcap_snp_c1_9865 PGSC0003DMB000000524 48794 CTTCTCCATTTGTGAATCCAGTGTCAATGGTCAAA TGTATCGGATTTGTA[G/A]TTTCTCTAGAAAAAA AATCATGAATCAAAGCACTACCACCTGTTACTCCG
solcap_snp_c1_9871 PGSC0003DMB000000486 129264 CAGGATATCTTGTCAAAAGAAACTCAGCTAGCTTT TCCCCTGTTATTTCA[G/A]CAGCTGAGCAAATAT ACCTCCCTTTTGCATTAGGATTTTCAAAAAGGAAA
solcap_snp_c1_9871 PGSC0003DMB000000199 917592 CAGGATATCTTGTCAAAAGAAACTCAGCTAGCTTT TCCCCTGTTATTTCA[G/A]CAGCTGAGCAAATAT ACCTCCCTTTTGCATTAGGATTTTCAAAAAGGAAA
solcap_snp_c1_9878 PGSC0003DMB000000102 1337623 ATTCCTCCAATTTGGTGTGAGCAAAGGCACGGTTA GCATAGTACACCGCA[C/T]TCTCACCGTTCAACT CAATTGCTTGTGTGTACAGATCAATAGCTTGCGAA
solcap_snp_c1_9898 PGSC0003DMB000000102 1456267 CAAGGAGAAGGACACGATGAGATCGATTTCGAGTT CTTGGGAAATGTGAC[G/T]GGTGAGCCTTATACA GTGCACACCAATGTTTATTCTCAAGGAAAAGGAAA
solcap_snp_c1_9900 PGSC0003DMB000000102 1457423 ATTGATGGCTGCGTCGTTAAATCAGGCGCTTCCTC ATGTGCCTCACGGTC[C/T]ACTGATTCCGCGAAC AATGCTAAGCCGTGGGAGACACATGAGCTTGATGC
solcap_snp_c1_9901 PGSC0003DMB000000102 1457483 GCGAACAATGCTAAGCCGTGGGAGACACATGAGCT TGATGCTAAGGGTCG[G/A]AACAGGCTCCGATGG GTACAGAACAAACATATGGTTTATAATTATTGCGC
solcap_snp_c1_9918 PGSC0003DMB000000102 1606568 ATGGCAAAAGATTTCAGGGGAAAAGAAGATGCTGA CCTGTTCCGGAAAAT[C/T]AAAAGTGATGATTTT ATGCGCTCTGCAGTGATCGAATGCTATGAGACACT
solcap_snp_c1_9944 PGSC0003DMB000000083 949774 TGTTTAAACTGGAACCATTCAGATCTTCATGACTC AAGTTATCTACACCA[G/A]TCTGAGAAGTAACTC TGCTCTCTTGGTCGACCAACATTTCATTGGCATTT
solcap_snp_c1_9995 PGSC0003DMB000000262 597528 TTATGAAAAAGAAATTTAAATATAGCTATGTATAC ACATTATTTGCTCTT[T/C]TTATGTATGGTAGGA TAACGTTAGTATTGAAAAAGATTGTGATTTGCTGC
solcap_snp_c1_10000 PGSC0003DMB000000262 473051 AAGGAGCGGATACACGGAAAAGCAACAGGAGGATC TTCTGAGAGTTCTGA[A/G]CCCAGTGCATCAGTA GAGTTGAATTCACGAAATTTTGATGAGAATGTTCT
solcap_snp_c1_10001 PGSC0003DMB000000262 470948 AACTTCTCTGCAACAGCTAACAACATTTCTAGGTA TTTGTTCCTTCCTTC[T/A]GCCTTGGAATCTAAT ATATCCGGCAGGAATGAAACAAAGCAGATTGCAGC
solcap_snp_c1_10011 PGSC0003DMB000000262 378042 ATGAACAATGAAAGCGGCCCCACCAAAATAACACG AACCCATCGCACGAC[T/C]TTTTTTCTGATAATA ACTATTGAAAGCGAACGACGCATGAGCCTCTAACG
solcap_snp_c1_10012 PGSC0003DMB000000262 377969 AAAGCGAACGACGCATGAGCCTCTAACGTGTTAGG ATTGTAACACGTGGA[C/T]CCTGGTTGAATCGAA CGGCAATCAGCTCCGCCCTCACCACAAGCATAATC
solcap_snp_c1_10013 PGSC0003DMB000000262 377939 TTAGGATTGTAACACGTGGACCCTGGTTGAATCGA ACGGCAATCAGCTCC[G/A]CCCTCACCACAAGCA TAATCTAGAGCTGCTTGTAGGTGATCCTTCTCCGC
solcap_snp_c1_10020 PGSC0003DMB000000262 376867 GGTCAGTATCGTAGACCTTCACACGCTCAACGCCT TGAGATTTCAACAAC[G/T]CTATAACTTTCACTG CTGATGGTAAGTTGTTAGCTACACGGCCATAGTTT
solcap_snp_c1_10031 PGSC0003DMB000000262 770039 GATTTCCGACGATTAACTGCTAACGATTCGGAATG GGGATCGAGTTTGCT[T/C]TACATGCCATTGATG AAGAATGTGTTCCGTTTATCAGTAGAAAAGCATCA
solcap_snp_c1_10042 PGSC0003DMB000000103 306103 ACTGTTCAGCAAGCTGCTGAACTGTCAATTGCTGC TCCTACAATAGCCTC[G/A]TCCCTAGATTCCAGA TTCCTTAGTGGATTGAAGGATGAAAGGGTGCAAGC
solcap_snp_c1_10050 PGSC0003DMB000000065 1674899 GCATCTGAGCATATTTCAGCACCTTTCCGTGCACC TGAATTGTGGGACTG[C/T]GCAAGTCAATGTGAT ATTGATGAAAGAACTGATATCTGGTCATTAGGTTG
solcap_snp_c1_10054 PGSC0003DMB000000074 1070958 TTAATATCTCTATGTACTATCCCTGTGGAGTGAAG TCCATCCAAAGCAAA[T/C]AGGAGTTGTCTCATA ATTGTCAATATGATTCTATTTTCTCTATCCAAACC
solcap_snp_c1_10069 PGSC0003DMB000000152 251277 AACGTCGCCGGAGAGAAGCAGCGATTCATCTTCCT CCACCGGAATCTCAC[T/C]CTTCAGTAAGTCAAT CGCCGCCTCTTGCGCCACCGTTCCCATCACTGATT
solcap_snp_c1_10109 PGSC0003DMB000000215 747152 AGAAGCTCATCATCATCGAGTTGCATACTTAATTC ATGGATATCCAACGT[T/C]AGGACCCCATTATCA ACGTCCATTCAGCTTAATTATGATGAAAATTACTG
solcap_snp_c1_10130 PGSC0003DMB000000215 862516 CACGTGTTCGCCGACGACACATCCAGGTTCATTCC GTTGTAGCCTTCACA[A/G]AAATACTACTAATCG GAGTCGCGGTCAATCGTATCACTCGAGTCATCAAT
solcap_snp_c1_10139 PGSC0003DMB000000059 635057 GATGGTAAATCAGCAAATACGAGGGAAAAGTATCA AAATAGTAATAACAA[C/A]GACAGTCCAGATTAC ATTAAAATACATGAGATTAATAGCCAATCCAAAGA
solcap_snp_c1_10144 PGSC0003DMB000000134 649880 GAGGCTGAGGCGGGATTTGATATTAGGATGCCGCC AACAGCTGACCCCGA[A/G]CTTATGAGGAAGATA ATCGAAGAGCAATGGGCACCAGCTTGGAGGAACAT
solcap_snp_c1_10157 PGSC0003DMB000000563 230351 TAAAGTTGAGAAATGAATGTGTCTTCAACTTTCAA GTAAGGATGAATTGG[C/A]AGCACTGTTGCCGCC GTCACTGACATCAAAAACACCGTCAAAGACACAAC
solcap_snp_c1_10167 PGSC0003DMB000000032 687691 AACAAAGCAAATATAAATATTCCAGCACCAAACTC AACAATCCAAAATCT[T/C]ATAAACCTCTTCAAT AAACAAGGTCTTAATGAACAAGACCTTGTTGCTCT
solcap_snp_c1_10168 PGSC0003DMB000000032 687729 TACCACTAGGAAGAAGAGACTCAAAGACAGCAAAT TTCAACAAAGCAAAT[A/G]TAAATATTCCAGCAC CAAACTCAACAATCCAAAATCTTATAAACCTCTTC
solcap_snp_c1_10169 PGSC0003DMB000000032 689016 CAAGCCTTTCCAGTTTCTAGTTCCAATAATTATGG TGGTCTATTCCCAGA[G/A]TTGTACCAAATCTCA TGTCCTCAAGCAAATGAAATTGTAATGTCTGTTTT
solcap_snp_c1_10178 PGSC0003DMB000000032 701852 GGCCACAGTTAAGACAGGACGAGAAGACGGATTCT ACTCATATGGACATT[G/A]GTAAAGGTGAGTACT ACTATATCGATCCAGTAAACCAGCAAGAAAGGTTC
solcap_snp_c1_10179 PGSC0003DMB000000032 701861 TGTCTGGTAGGCCACAGTTAAGACAGGACGAGAAG ACGGATTCTACTCAT[A/G]TGGACATTGGTAAAG GTGAGTACTACTATATCGATCCAGTAAACCAGCAA
solcap_snp_c1_10180 PGSC0003DMB000000032 702054 ATTGATTGTGGATCAAGTAAGTTGCAGAGCGAACA AATTCCTATTGCTCA[C/T]GGCTTTGGTCCTAAA CCGACTAGTGATGGAAGCATCATTGGTGCTGTCAA
solcap_snp_c1_10181 PGSC0003DMB000000032 703197 ACATCACTTGCCCTTAAAACCATATCTCGCCAGTT TCGCTGCTTGAGGGA[C/T]GCAATCAAGAAGCAG ATACAAGTTACACGTCGAAGCTTGGGGGAGCAGGG
solcap_snp_c1_10196 PGSC0003DMB000000032 867882 GATGCAGACATACGTTAGAGGAGTTTCATGCCCAT TAATTTGCCTCAAGC[G/A]TCAGGATCATGGTGT CCTCCTAGTTGGTTATGGTTCTGAAGGTTTTGCAC
solcap_snp_c1_10202 PGSC0003DMB000000032 899497 TGAAATGCAGTTTTCCGATCAGATCTGAGTTGAAT TTGATCTCGAAATCC[C/A]GTTAGGGTTTCACAT ACAGCAAAATTAGTTGTTGTTTTTGAGCATTTGAT
solcap_snp_c1_10249 PGSC0003DMB000000341 369003 CCTTGAGCGCGTAATTATCAAAAACTGTCCTTCCT TACAAAAGATCCCTC[A/G]AGGGTTTGCAGATAG TATGACACTGCAGCTAATTGAGTTACGGGGATGTT
solcap_snp_c1_10250 PGSC0003DMB000000341 369002 GCCTTGAGCGCGTAATTATCAAAAACTGTCCTTCC TTACAAAAGATCCCT[C/G]AAGGGTTTGCAGATA GTATGACACTGCAGCTAATTGAGTTACGGGGATGT
solcap_snp_c1_10252 PGSC0003DMB000000433 77055 CACCAAGCAAAATCCTAACTAACGTATCATTAAAC TGATCTAAAATCAAC[T/C]TCAAAATCGACTGCC CTTCATGCTTCTCCAATTCATTAAAACCATAGATC
solcap_snp_c1_10253 PGSC0003DMB000000433 77270 ACACTCTTACCACCTAAATTCTCCCTTTTCCCATA ATTTTCACCTCCTTT[A/C]CCCATTTATAACCTC CAGAATCAGCCAAATCTAATAAAAAACCAGTCAAA
solcap_snp_c1_10255 PGSC0003DMB000000433 101907 GTTCCATTATGAGCAGCAGAAGCACCGGGATCAAC TTGACTGAAATCATC[G/A]ACTTGTGGAGAGAGC TCGCCAATAAGGATGGTGCTGTTTTCTTCAGGATC
solcap_snp_c1_10256 PGSC0003DMB000000433 101925 GAAGCACCGGGATCAACTTGACTGAAATCATCGAC TTGTGGAGAGAGCTC[G/A]CCAATAAGGATGGTG CTGTTTTCTTCAGGATCATCTTGAATGACAGCTTC
solcap_snp_c1_10269 PGSC0003DMB000000433 146660 ACTCGAAGCTATCCTGTGCACTAGAATACAGTTGT TGAATTTCCTCTGAC[C/T]GAAGATTGCATTTGA TGAAGAAAAAAGCAGTTGGTCTAACATTCAATACT
solcap_snp_c1_10270 PGSC0003DMB000000433 148665 TCCCATGAAGGCTTCCAAGAGCTGAATCAATGTCA CATGATTAACAGCAA[A/G]GTTTCTCAGGAAATG TTTGACAGCATTGTCCGTGAAGTTGTTGAAGAAAT
solcap_snp_c1_10295 PGSC0003DMB000000008 147649 CTTTTAACACTTTCCTGTAATACTAACGGTGAGTT CATAAGTTGAAGCCT[A/C]GCAAGTGGTATGAAA TATCCATCCATACAAAGTGTCTTTGTAGTGGTAGC
solcap_snp_c1_10297 PGSC0003DMB000000008 150196 ATCATGCTGAACTGCAGATGCGGGCAAACAGGTTC CTTCCGTTGTTGGCC[T/C]GGAAATCTGTCCTGT ACAGGGGCCCATACCCTTGGGACCTGAAACTCTAG
solcap_snp_c1_10315 PGSC0003DMB000000008 1298588 GCGTCCATTTGACAATAGCAAATCAGATGGACGAC TCAGAAATAACATTT[C/T]GAAGCCAGTGAAAGC CTAATATTTTACTGACCATCCATACACCGATCTTG
solcap_snp_c1_10351 PGSC0003DMB000000472 355821 GGGATTTGATCAGTGAACCACTCCATAACATGAAT TGGGGCTTTTATCAA[C/T]TCCAATGCCAATTCA ACCAACACAGTTACACAAAGGCAACAAGGGCATAT
solcap_snp_c1_10354 PGSC0003DMB000000073 1613132 GTCAGGAATCCAGTTGGAAATCCTCTGGCTGGAAT TGATCCTGAAGAAAT[A/T]GTTGACACAAGACCT TACACTAATTTGCTCTCCCAATTTATCACTGGTAA
solcap_snp_c1_10358 PGSC0003DMB000000073 1534661 GAGTGCTTTTGAAGTACTCCAAAGCGTTAGCAGTC ATGCCTTGTATTTGC[T/G]TTAGGTTTGCAATCA GCGTCGTTGTGTTTACTGTAGGCTTGTAACTTGCA
solcap_snp_c1_10369 PGSC0003DMB000000112 383380 GCCAAAATTCTTTCAATTTGTCGATTTGGAGCCGA TGCAATCTCAATCTG[C/T]GATGAAGGACCCAGT AAGCAAGCATCTTAATTACATCTATGGAGATTGAG
solcap_snp_c1_10384 PGSC0003DMB000000445 319202 ATACCTTTTTACGGTGGAGCAGATTACCATGACTA CCATCACTATGTTGG[A/G]GGCCAAAGCCAGAGC AATTTTGCTTCAGTTTTCACCTACTGCGATTACAT
solcap_snp_c1_10390 PGSC0003DMB000000445 419380 TGAATCATCAGCATCCTTTCTTCCGTTGTTTGGCT CGTTGGAACTTCCAC[C/T]ACTACCATCCTTTGG GGCACCAGGGATCAAGTCAGGTCGAGCTTCAACAC
solcap_snp_c1_10391 PGSC0003DMB000000445 419353 TTCTGAGTCTCTTTTATCATTTTCTGATGAATCAT CAGCATCCTTTCTTC[C/T]GTTGTTTGGCTCGTT GGAACTTCCACCACTACCATCCTTTGGGGCACCAG
solcap_snp_c1_10397 PGSC0003DMB000000274 358369 GACAAACTTGCCGAGAGCGCCGAGGTTGAAATGGA AGTTATCCCTATGGG[T/G]GTCAATAATCATGAT ATCTCCGGTGCGTTTAGGGTTGCCTCACCTATGGT
solcap_snp_c1_10407 PGSC0003DMB000000771 127236 GAAATGTCCAGAAGAGCTGCTGCACGCGGTAATAT ATTTTTCCCAAATGA[A/C]CCTGATGCAGCAATT ATGTGTGAATAGCCACCACTCTGCTGAACAAGATG
solcap_snp_c1_10416 PGSC0003DMB000000184 340663 TGATACCCCGTGTCTCTTAACGGAAGGCATTTGAG AATTCACGGTTCCTC[G/T]GTTACTCATAAGAGA TGATTGTCTAACAACTACAACATTGTTAATTGGAC
solcap_snp_c1_10424 PGSC0003DMB000000184 265934 TCTTCAAGAGCCCTGAAACGTGTTCTTTTGGTAGC ATTACGCTGTGTTGA[C/T]CCCAATGCTCAGAAG AGGCCAAAAATGGGACAAGTAATACACATGCTTGA
solcap_snp_c1_10425 PGSC0003DMB000000184 265868 CTTAAAATAATGGTTTCAAACCGGAATGCCGAGGG CGTTGTGGATCCCAA[G/T]ATACCTGAGAAGCCT TCTTCAAGAGCCCTGAAACGTGTTCTTTTGGTAGC
solcap_snp_c1_10428 PGSC0003DMB000000184 265140 TGTTCCAAGAATGATATCCATTCTAATTTCCCATG TAAGAGGACTGCAAG[G/T]CCCTACATCTCCATG GAGCCACTGTTCCAAGTTCCCATTGTCCACATACT
solcap_snp_c1_10435 PGSC0003DMB000000184 123021 ATATGACTTTCAGTGCGACCTATGCATTCATAACT CCAGCTACCAAATCG[G/A]CCATGTAGTGCTTAC AACAACAAGCCTAGTGAGAACGTAAGCCTGGTCTG
solcap_snp_c1_10441 PGSC0003DMB000000213 569521 CCAAGAAGGCCAAAGGCAAACCAGGAAGCGCCACA TAAGAACACGAACAA[C/T]GACAAGAAAAATGGC ATGAACTCCACACTCTTCGTCTTGATTACCAATCT
solcap_snp_c1_10457 PGSC0003DMB000000102 42631 TTTTGCTCTCCATACTGCAAAAGGTGTTCTAGTGA ACGTATGGCCATTTC[G/A]AGTCCAAGTTCTTCA GCCATTGCCACCATTGCAATACCCAGGACGGCCGG
solcap_snp_c1_10461 PGSC0003DMB000000102 44740 GCAAGTGTAAGATAGCCTTCACTTAATTTAGTGTT GTTAATAATCTCCTG[T/C]AATCCTTCTCTTTCT TCATCTTCTGCACACATCTCTTCATCAAGCTCAAA
solcap_snp_c1_10467 PGSC0003DMB000000760 130364 GCTACTATAAGTGTTTGACTATTTATCAGCATTGC AGTAACTGCAGTTGA[C/A]CCTCCTTTTCCCAAT TCGAATGCTTTTGCCAGAATGTCTTTGTCTGTACT
solcap_snp_c1_10471 PGSC0003DMB000000443 331430 TTATTGAATCAGCCACCTGGCATTCTACGGAAGGG CCAAGTCATTGACCG[T/C]GTCCATTCAACATTA ACATACATTGCAAAGTTACTTCCTCTCTCGCCCTT
solcap_snp_c1_10477 NM NM CAAGAATAGACTCATAGTCAAATCCCTCCAATGGG AGCCCTTCCAATGAC[T/C]TCCCTGTAATCCTCT GTAACGCCTCTTTTCGAATCGAAGCAGCTCTCATA
solcap_snp_c1_10478 NM NM CCATCAAGCAACAAAGGCCCAGCAATACCCACCGG TATTTGCACATATCC[T/C]ACAGGCATCTCACAG CACTGTCCAAGAATAGACTCATAGTCAAATCCCTC
solcap_snp_c1_10479 NM NM GTGGAGAACCGGACAACCGGAGCTCTTGTCATCCC ATCTCTGAGCAAAAC[G/A]CTGTCGGCGCCACCA GAGACAAAGATAGCCTTGCAACCCCTGTTGGTGCT
solcap_snp_c1_10480 NM NM GAGGGGATCCTCAACGAAGAATTTCAACTCAGCGG CTCTTTTGGCGGTGG[A/C]GAACCGGACAACCGG AGCTCTTGTCATCCCATCTCTGAGCAAAACGCTGT
solcap_snp_c1_10491 PGSC0003DMB000000443 131076 GCAGCAACATCTCTCATTGTAGTGTCAACATTATA AGGGATACCGTCAAC[G/A]GTGATTGCCGTGGTG TTGACCAGCTGCCGGCATGGTTCACGGTGCTCTGC
solcap_snp_c1_10492 PGSC0003DMB000000443 118280 AGGCAATGGGATTGAAGGTGTTTGATAACCCTAAG TTGTTGAAGGAGAGT[C/T]TGAAGAAGGATAAGA GAAAGAAAGAGAAGAGTTCTGAGAAGTGGAAGGAA
solcap_snp_c1_10493 PGSC0003DMB000000443 117987 GCTTAAACTTGACTAGCACAGAATTAGCAAAAGAT TTCAGACCAAACACA[A/C]AACTCTCTCCAAATG AAAGAGCAGCTAAATTCAAAATAAGAAGCCATAAG
solcap_snp_c1_10494 PGSC0003DMB000000443 73687 TTCCATGTACTGATAAAATAGGGCGAAGATAAAAC AAGCAAGTAAAGTAA[C/T]TGCATAGCTAGTCCA TGAATCAGTTCTCCAGAAATCGAACAAAAGGGTTA
solcap_snp_c1_10496 PGSC0003DMB000000443 417423 TACCTACTTCCTTTTCACCTTTGAGGAGCAGGCTT CACAAATGAGAAGTC[A/G]TCTTCATTCCTAGTA GATTCTCCATTTTGAGGAATATGCACATGAATTTC
solcap_snp_c1_10510 PGSC0003DMB000000099 243543 AATCCAGTCTTTAACTTCCAATTCTAGCAACAAAC AAAGTGAGAATACTA[A/C]TACTTTTTTAACCCA TAAGTATTGTAAAGCTCTAGCTACTACTTTTACTG
solcap_snp_c1_10514 PGSC0003DMB000000099 354453 TCAAGAGAATTGATCCTGGTGGAGAGAGTTCCAGT GAGGCATTCTCCGGC[C/A]AAGGGATTCCAGAAA TTGAGCCCTGGTTCTGCTAATCTGTCAAAACGTCC
solcap_snp_c1_10519 PGSC0003DMB000000099 66829 ATATCCAAAAACCTTTGTAATCACAGTGGCTACAG TAGTCTTAAAAACTA[T/C]AACCAGGATAACGGA GGCAAGCAAGATATCCACATGTGTCCAAAGGAACT
solcap_snp_c1_10528 PGSC0003DMB000000177 230969 GAACACACAAGAGGATTACTGTTATTACACAGGGT GCTGATCCTGTTGTT[G/A]TCGCTGAGGATGGGA AGGTGAAGCTGTTCCCTGTTATACCGTTGCCAAAA
solcap_snp_c1_10529 PGSC0003DMB000000177 230971 ACACACAAGAGGATTACTGTTATTACACAGGGTGC TGATCCTGTTGTTGT[C/T]GCTGAGGATGGGAAG GTGAAGCTGTTCCCTGTTATACCGTTGCCAAAAGA
solcap_snp_c1_10539 PGSC0003DMB000000177 399052 AAATCACCCCTTTCTAAGGATATCGATCTCAGAGC TCTTGCAAAATATAC[G/T]CAAGGGTTCAGCGGA GCTGACATTACAGAGATCTGCCAACGTGCATGCAA
solcap_snp_c1_10555 PGSC0003DMB000000634 20464 ACTCATCCAAAGAAGCTTGATCGAACTCCCTATGT CTTTTCCTATTATGT[T/G]CTGATATCTCCCTAT TGTACTTTGCCTCCTGCAACTGAAGCTCTTTCATC
solcap_snp_c1_10560 PGSC0003DMB000000005 682877 ATGACATTTCCAACAATGTGAGAACCTAATGCCAG TTTTGGTGAAGACCT[C/A]TTCTTCAAAGAATCT AGGTAGAGTCTAAGACCAGTGATGTAATCCCTTGG
solcap_snp_c1_10569 PGSC0003DMB000000280 697832 AATTGATTGCTTATTGTGACATATGTAGTCTACAA GGTGAAGCTTTGGAT[A/G]TAGGTCAAGTTGCTT TCAAGACTAATCTCAACTTGTTGTCAAACACACTT
solcap_snp_c1_10579 PGSC0003DMB000000280 733435 TGAGGTAGAGAAGGTAGTAGAAGAGACAAGTGATA ATGGAGCTAAAATTA[T/C]TAGCCAGGCAGCTGT TCCTGACGTAGTAACAAGTCCGTTTGTGGAGCAAT
solcap_snp_c1_10590 PGSC0003DMB000000280 450369 GATCTCCGGCAGTACAATCAGCAGCAGCAGCTGTT GATATCTAGGGTTCC[G/A]CCGTATGATGGCGTT GCCGTCGGTGATCAGAGGATCGATTCTTCTTTTCC
solcap_snp_c1_10593 PGSC0003DMB000000004 3176175 GGTTAAAGATGCAATTAAAGTAGCTAGGATTCATC TAGGTACTTTTAAGC[T/C]CCTTGAGGAAAAAAC ACCCCCAGGAATTGTGGATAAGTTTGGTTGGTGTA
solcap_snp_c1_10607 PGSC0003DMB000000004 3056538 AAGATTGTTTGTAATTCAGTGATATGGCTTCTGGC AGTATTATGTCTTCA[G/T]CAGCTGGCAAACCTA TTACTGATGCTATGCTTATTGACAACCTACCTAAA
solcap_snp_c1_10646 PGSC0003DMB000000215 223112 ACACGCAGACTTTCAAGTGCTAGCAGCTTGAGTAG TATGGAGGAAAGCTA[T/C]TTTCTGCAAGCATCT TTGGACTCGTCTGACAATTTATCTGAGCGTAGAAA
solcap_snp_c1_10667 PGSC0003DMB000000032 1383581 ATTTAATAACATTTGCTGGGATTGGAGCTTCATCC CTTGGAGAAATCTTG[A/G]AAGGATCATTCACAT CTCCTTTCACTCTTATATACAATTCTTGTCCAAGA
solcap_snp_c1_10668 PGSC0003DMB000000032 1383516 TCTCCTTTCACTCTTATATACAATTCTTGTCCAAG ATACCATTTTTCTGC[A/G]TCCTGTGATCTCAGA TTCCACATCCCTTGATTGTCCAACTTTATCAGTAT
solcap_snp_c1_10669 PGSC0003DMB000000032 1383050 ACAACAAAGAAGTTGTATCCATCAGAATGCCACGT TTGTAACGAGTCTAA[T/C]GGATTTTGGAAGACA ACATGAACAAAATCATGATAATTGGCATCAATGAC
solcap_snp_c1_10670 PGSC0003DMB000000032 1382831 GATACCCCATTAACAGTGTATCGATTTTGTCCATC CAACGCTGCCTCACC[G/A]TTCTGGAGGATCAGT GTCCGGCTTATGTTAATGCTTCCATATACATAAGA
solcap_snp_c1_10676 PGSC0003DMB000000032 1309653 GAGCAACTCTACCAATAGCACTTTCACCGAAATCA GCAGTTATAGTCTCA[T/A]AGTTCCTAACAGGAT CATGAGATACTTTAAAACTTGCAGGCATAACTCCA
solcap_snp_c1_10677 PGSC0003DMB000000032 1308383 TGAGAGTACTCTTCCGTTTTGTAGCGGTATATATC ATTCAGTTGTTTTAT[A/G]TCGAGCCAATAGTAA CTTCTCATGTGAAAGCTCAAAGCATGAAGGCGTTT
solcap_snp_c1_10678 PGSC0003DMB000000032 1308347 GAATCTGGCATCACATTAAACTTGTTTACTGCGGT GTGAGAGTACTCTTC[C/T]GTTTTGTAGCGGTAT ATATCATTCAGTTGTTTTATATCGAGCCAATAGTA
solcap_snp_c1_10679 PGSC0003DMB000000032 1308197 GCGGAAGCTTGCTCAGGTGTAGCCAAAGATGACAA GATTGAAATACAGTT[A/T]CCCAAACAAAACCAA CGGAAGTCCATGTGAGCAGGACTAACATTTCCGAT
solcap_snp_c1_10711 PGSC0003DMB000000032 1457341 ATGTTTCTGTGCCTGATCCTTCCTAGTGTTTGGAT TTCAGCTGAGAATCC[G/A]TGATCATGGTGTCCA GTTCCTCGGCCTACAAGTTTCTTAATTGCAACGTC
solcap_snp_c1_10712 PGSC0003DMB000000032 1457272 CCATTCGACATGTATTCGTACAACAACAAGTTTGT GTCTTTGTTTGAGAC[A/G]TATCCTAGTAATCGT ACGATGTTTCTGTGCCTGATCCTTCCTAGTGTTTG
solcap_snp_c1_10713 PGSC0003DMB000000032 1457155 GGCGAACAATCATGGTGCAAATAACACAATCCCTT TGCAGCTTCCACAGC[A/T]ATACGGTACCTCGTC TCCCATTTCAAATGTGCTCCTTTGGCACCATGTAA
solcap_snp_c1_10714 PGSC0003DMB000000032 1456282 TCCCCGAATTCACCAACTGGCTTGTGACCTGTGAT AAGTTCCAACAGTAC[A/T]ACTCCAAAACTGTAT ACATCACTCTTTTGGTCAACTTTCAATGTGTATGC
solcap_snp_c1_10715 PGSC0003DMB000000032 1441934 GGAGCAGAGAGTTGTTGACGAGCTTTTGATATTTT GAAATCAATTGAAGT[T/G]GTTCTACGGTGGCTG TGTTCATCAGCAACGGATTCAGAGTAAGAAGAGAA
solcap_snp_c1_10725 PGSC0003DMB000000491 267642 TTAGAGAATTTGCGTAGGGTTTCGGCAGTTTTAGG GTACTGGTTGAATTG[A/G]AAAGATGTCAGGGAA GGTTCAAGATTATCGAATTTTTGTTGGTGGGTTAT
solcap_snp_c1_10737 PGSC0003DMB000000491 213973 GACGATAGATAAAACACAACCCCCTAATCAAGACA ATAGATAAAACAACC[C/A]TAAAACTGATTAAGA GCTGGTAAATTTGGTAACAGCCTTTGTACCCTCGG
solcap_snp_c1_10738 PGSC0003DMB000000491 187964 CCAGAGACAGTGTGGCGTTGCCTAAGATGAACTAG TTCGCTTGCTGCCAT[T/C]GAAGGTGGTCTCTCT TCCTCAGCAGGCCCTTCATTTCGCAAGAACCTTCC
solcap_snp_c1_10743 PGSC0003DMB000000491 112351 TGTGAATCGGCGATTCAGCTTCGGGAAAAGGGAGA AGTGGTGGTAGGTGA[G/A]ACTACTCTCAAGTAC TTGGGATCCATCCATCTTCAGCAAGGAGTTGCTGA
solcap_snp_c1_10750 PGSC0003DMB000000420 99904 ATGCATACGTAACGAGTGTTTTCATCTTCATAATG AATGTGCTCCATCAC[G/A]GTGCGCAGAGATTTT TCCCTCAATCTTTTCCCCGGCCAATGCATCAAAAT
solcap_snp_c1_10751 PGSC0003DMB000000420 108504 AAAAGAGTCAAGACTTGAAGTATCATCTGGAACTG CAACTCAATTAGCTT[T/A]GAGTACACGAGAACG ATATTCTCCCAATGCCCAGATTGGGAAAATGTTCC
solcap_snp_c1_10761 PGSC0003DMB000000420 138730 ACTATGCAAATCCTTCCGTCTACCGATTTCACACC TAACCTCACTCTACG[T/G]CGGCTTATCAACGTC TGGATTCAGCATCAGCCGGCGAGCTCACCGGGATC
solcap_snp_c1_10762 PGSC0003DMB000000420 138733 GCCACTATGCAAATCCTTCCGTCTACCGATTTCAC ACCTAACCTCACTCT[A/C]CGTCGGCTTATCAAC GTCTGGATTCAGCATCAGCCGGCGAGCTCACCGGG
solcap_snp_c1_10777 PGSC0003DMB000000420 287982 CATACAAGTCGCCACCTCCACCAACTCTCGTTTAC AAGTCGCCACCACCA[T/C]CCAAGGAGCCATACT ACCCTCCACACACTCCAGTCTACAAGTCGCCACCA
solcap_snp_c1_10781 PGSC0003DMB000000047 1083624 GACACTCAATGTACACCAGCTTCAGACGAGAAATC TCTCATGAAGAAAGT[G/A]AACTCTCTGTGCTGC CTCTTGCAGGATCCTATTGCGTCTCACGAGCCCCA
solcap_snp_c1_10783 PGSC0003DMB000000047 1083828 AATAGGAACTTTGGAAGGGATGCAATACGAGGAAG ATGAAGGAGCAAGTC[G/A]CCAAAGGAGTCTATC CTTGGAATACTTGGTGTCAGTTTACCACCAACAAA
solcap_snp_c1_10788 PGSC0003DMB000000047 1122903 AAGATTCTTGATCAGGCTAATGAAGAAATCGGAAA TATTGATAGCTACAG[C/T]ATCTTCACTCCAGCA TGCACAGCCAAATTTAGTATACTAAACCACTTGCT
solcap_snp_c1_10825 PGSC0003DMB000000047 1320498 CCACTCACGTAACCACCACTACCCTGAGGCAGAAG TTTTGGGTTCAATGC[G/A]GGCGACTTGCCAACC AATGGTGGCTGACTTCGTCCACCAGCCTGAACCAG
solcap_snp_c1_10836 PGSC0003DMB000000047 1049566 TTGTTTGTAGTTTGGAGTGGGAGTCCATAGCCATC TTGACAAGGTCTTGA[T/C]TGCTTCTTCTGAAGC TGAGAACTTTGGCTATACAGCAGCAGATTTTGTTG
solcap_snp_c1_10838 PGSC0003DMB000000593 92055 AAGAGGCTCAGAGGGGTGTTTAACTGGCTTGAACT CAACTGCAAATTCAA[T/C]ACCATGAGGCGTCCC AGAGAAAGCCCTGTCTATAGTAGCCTCTGAATTTG
solcap_snp_c1_10855 PGSC0003DMB000000058 1488076 TTGTTATTACGAACCAAGTTGTTGCTCAAGTGGAT GGTTCTGCTGTATTT[T/G]CTGGGCCTCAAATAA AACCCATTGGTGGCAACATCATGGCACATGCTTCA
solcap_snp_c1_10858 PGSC0003DMB000000214 454269 GAGAAAGACGATGCATGTTAGACACAGAGTTTGTA GTCCTGGTAAAATTT[C/T]CCTGATTACTGGCAA GAGTTTGGTGTAATTGGCAGAATTTACATGGTGTC
solcap_snp_c1_10869 PGSC0003DMB000000584 192488 TCCTGTACTGTTGAATATCTGATGCTTGTCTGGAG GTTGAACGGTGAGAT[A/G]TACTCTCAGAGAGTT CCACATTAGGAATCACAGGTTTATGCTTCATTGTT
solcap_snp_c1_10873 PGSC0003DMB000000665 96711 ATTCCTGGGGAGACTTTTATTCCCACAAGCTTAGC AGCTGCCTCTTCATC[A/G]AATCAATTGTGGATG GTCATGGGTGCATCAAGTCTATGTACTTCTGATTC
solcap_snp_c1_10879 PGSC0003DMB000000271 178317 GGTGCTGATGTTGTCCAACATATAATAGATAATTT TCTTCTATAGAAGTC[G/A]ATCAAATCTGAAGCA CATTGGATCGTGGTGGAGAATGCTGAATTTACAAG
solcap_snp_c1_10881 PGSC0003DMB000000271 184727 AATGTGCAGAAATTCTCGGATGATACCAGTGAAGA AGGGTCAAAGGGGAC[A/G]ATAGTCGGCCTGGCA CCAATAAATTTCATCACTGTTGCCTCACCTCATCT
solcap_snp_c1_10885 PGSC0003DMB000000271 315905 TTACAAACTCCTAAATGTTATGAGAAAATCAAGTA TGATGGTAAAGAGTT[C/T]CAAACTTTTTTCTGA TGTTCACCATGGATAAAGACATTCTATCTGTGCAA
solcap_snp_c1_10900 PGSC0003DMB000000237 493976 AGTTCTCCAAATCTCATGCTGAATTGCTGCATTCT GCTCTCCACCGCCTG[A/G]CGATTTAGATATTGC ATTTGCTATTCCAGGAAAGAAATCTAACTCACTTT
solcap_snp_c1_10901 PGSC0003DMB000000349 242610 ACCACAGATTTCACAGTTTCATAGAGCTTAGGACA TGATTTTGAGTAAAA[T/C]CCAGTGGTGAGTTGA GCTGAGGAACTTCCCACTAAACTCACTAGAAAAAA
solcap_snp_c1_10903 PGSC0003DMB000000660 191752 ATATCCTCCGTACTTATGTTGGCTCTCCATGCCTT CTTCCCTTTCCTTGA[G/A]CTCTTTGCTTTCTTC CCCATCTCTCTACCTTCGCTGCAAAGGCGGCAAAG
solcap_snp_c1_10915 PGSC0003DMB000000469 175832 AGAACGGAGAGAAACTCTTGACCGACGGCGCCAGT AACTCCGACGACGGC[A/G]ACGGATGGGCCGTTT TCCTGGAGAGACATACGGACACGGAAAGGGGAAGA
solcap_snp_c1_10918 PGSC0003DMB000000469 160061 GATCCTTGGAAGCAAAATGCTTGTTAAGTTTGATT ATAGCAACAGGATAC[C/T]CATTCTTGGACAATC CCTGTAAATAAACTTTTTCAGCTGCTGATTCATCT
solcap_snp_c1_10920 PGSC0003DMB000001123 10046 CATTGTGAAAATTTCCCACCAAACCTTAAGAAGTT AACATTGTGCAGAAC[G/A]TACCTACAATGGGAA GACATGAACATTCTCAGAAAATTACCTAATCTTGA
solcap_snp_c1_10920 PGSC0003DMB000000469 148809 CATTGTGAAAATTTCCCACCAAACCTTAAGAAGTT AACATTGTGCAGAAC[G/A]TACCTACAATGGGAA GACATGAACATTCTCAGAAAATTACCTAATCTTGA
solcap_snp_c1_10921 PGSC0003DMB000001123 10047 ATTGTGAAAATTTCCCACCAAACCTTAAGAAGTTA ACATTGTGCAGAACG[T/C]ACCTACAATGGGAAG ACATGAACATTCTCAGAAAATTACCTAATCTTGAG
solcap_snp_c1_10921 PGSC0003DMB000000469 148808 ATTGTGAAAATTTCCCACCAAACCTTAAGAAGTTA ACATTGTGCAGAACG[T/C]ACCTACAATGGGAAG ACATGAACATTCTCAGAAAATTACCTAATCTTGAG
solcap_snp_c1_10924 PGSC0003DMB000000469 105847 GCTACTCGCAGTACACCAGATGGTAGAAGTTCAAG CAATGGTCCTTCACG[C/T]CGGCAATCACTGGGA GGCGCTGAAAACATCTCCAAATTAACCTATAATGG
solcap_snp_c1_10930 PGSC0003DMB000000469 347785 AAAGAAAGAGCACCTGGTTCTGTAACCTCTGCCTC AGAAAGACGAAGAAC[G/A]CAAGTGATCCTCGAT AACTTACTCTTTTCTTCTCTGGTTGTATCCATTAA
solcap_snp_c1_10932 PGSC0003DMB000000890 48881 AAGTTGCAACAGAACCAAGGAGAAACATACAAAGT CAAAGAAAGAACAAT[A/C]CAGTAACAATTGTTG ATTCGTACCAGCCCCAAAAGCTACTTATGGTATGA
solcap_snp_c1_10934 PGSC0003DMB000000890 61754 TGAAGCAAAGCACACAGCTGCAGTTGTCAATGAAC TGTCTAAAGAAATCT[C/T]GCGCATTTTGCTTGC CCATCCATTGAATGCAAAACGGGCAGCAGAAGGAA
solcap_snp_c1_10935 PGSC0003DMB000000890 62143 ATGGTAGCTCCTACCAAGATTATTGCTGGCTTGGG TTTGTCACTCGGGAT[T/C]GATATTCTGGAAGCT CCTGGAGCGACAGGAGACTATAGGACATTATTAAC
solcap_snp_c1_10938 PGSC0003DMB000000681 108358 AGAGTTCCTTATGGACCAAACAAAGACTATTTTAT ATACTCATTATTTCT[T/C]GTCTTCTGCAATCGG ATTACCACCTCTGCAGTCTCTGCTGGAGTTTTACT
solcap_snp_c1_10939 PGSC0003DMB000000681 136930 AGAAAATAAACAAAAGTTTCCACTTCACAATACAA TAACACGAATGACGA[T/C]GGAAAATATAACTAC TCAGTAGCGAAAATGTAACTCTGCTTTGCTCAGCT
solcap_snp_c1_10941 PGSC0003DMB000000006 2669759 TGTAGGAGAAACCATGCCGGTCCAAGTAATGAGGA CTATGGTTTATTTGC[C/T]GGTTTTGATTTTATT TGGAACGATTCTATGAGGTTCCAATCATTCCCTAT
solcap_snp_c1_10958 PGSC0003DMB000000300 256372 CATCTGGCATATGTTTGAGAAGACTTGACAGACAT GAAATAATATTGTGG[T/G]TTCCTAATCACTTAC CCTCCTGCTGATAAGAGTTTCACTAAACCTCTCGA
solcap_snp_c1_10974 PGSC0003DMB000000300 192779 ATGCCTTCTTCTTCTTCAATGAGAGATTCAGCATA TCCATTCTTATCGTC[T/G]CCGGAGGAATGAGGC TTATCAGTACCGACCGTAACTTTGGAGACGAGATG
solcap_snp_c1_10975 PGSC0003DMB000000300 192687 GACGAGATGCCACTGGAAGAGCGAGAAAGCGATGC CGATAACGGCACATA[T/C]CGGAATCAAAATCTC CATTCCGAGATCTGTTAAAATAGTCACACCCATCT
solcap_snp_c1_11008 PGSC0003DMB000000431 168843 CTCACAGAGACAGTTACAGAAGCAATAGCAGCAGG TTTTTCTGGTTGGTT[G/A]CTGGCAAAAAAGAAA AATGTTTCTTCTAAATGTTTAAGAGTCTCCATCGG
solcap_snp_c1_11013 PGSC0003DMB000000431 196195 ACATGGTCCTCTTTGTTATATTTCTGCGCAAAAGA AATTCCAATACCTAG[A/G]GGAACTTGAGCACCT ACAATTCCATGTCCTCCATAAAATCCACTATCCTT
solcap_snp_c1_11023 PGSC0003DMB000000431 216721 CAAATATCAGATAATTGGGTGATTCAAACCCTAAT TTTACTATTTCCGAT[G/T]CTGAATCGGTTGTAA TTTTTGAATTTTTAAGCTTAAATTTGATCTCCGGT
solcap_snp_c1_11025 PGSC0003DMB000000431 224074 ATGACGTCCGGTAGTATAGAACGAGTAGCTTTCTT AGCACGCTTAGACAC[T/C]TTTTTGAACATACTC TGCACAAATCTAACTAGTAAATCAATACTGCTCTC
solcap_snp_c1_11027 PGSC0003DMB000000431 258188 CTTTGAGCCTGAACCAAATTGGCAGGAAGACTTTC CCTCCTGTATGAGTC[A/G]AAGTAAGCAAGACTT GAAGACATACCCGGTGTGCTAATGCCTGAGTTTAT
solcap_snp_c1_11030 PGSC0003DMB000000431 258884 AAGACTTGATGTAATTCAGCGTTAGAGAGCTTGCC GACAGATCTTAGTAC[A/G]TCGTAAGCCTCTGCA ATTAACTGCATGTCACCATATTCAATTCCATTATG
solcap_snp_c1_11031 PGSC0003DMB000000431 258887 ACTTGATGTAATTCAGCGTTAGAGAGCTTGCCGAC AGATCTTAGTACATC[G/A]TAAGCCTCTGCAATT AACTGCATGTCACCATATTCAATTCCATTATGAAC
solcap_snp_c1_11033 PGSC0003DMB000000431 259313 GCCTTGACAAGAATGATTATGACACGGGGCTTTTG GATAGAAAGTACAAA[G/T]GACTCTGGATCATGA AAGCCATAAAGAGGAAGATTGCCTTCCTTTTTAGC
solcap_snp_c1_11066 PGSC0003DMB000000001 300913 CAAATGGTAGCTAGCACCAGAGTCAAGAGTTGTTG ATGCAAGATCAAGTG[C/T]GAGTGAGAATGGTAC ATCCCAGTAACTCCCGTTCCCATCAACAAAAAGTC
solcap_snp_c1_11076 PGSC0003DMB000000540 75210 TTGCCAACATAAACTGTTGTTTGTGGTTTCTCTGT TTGAGTAATGCTTGG[G/A]ATGGCAGCTGGCCTG GCAACAAGAGGAATGATTGGAGGACGCATCATAGG
solcap_snp_c1_11078 PGSC0003DMB000000540 75180 TCTGTTTGAGTAATGCTTGGGATGGCAGCTGGCCT GGCAACAAGAGGAAT[G/A]ATTGGAGGACGCATC ATAGGGATTGGAGGGCGCATCAAGGGAGGAATAAT
solcap_snp_c1_11088 PGSC0003DMB000000540 269519 AAGGGATCAATGAGGCTTGCAGTGGACAGGTGGGG ACGTATTGAAGTTAC[C/T]GAACCTGCTAGTTTC TCTGTCAAGGAAGACAGTAATCTGTCCCTTATCGA
solcap_snp_c1_11092 PGSC0003DMB000000505 281839 TTCCACTAAGTTTAGAGCACCCAGAAGAGCTTTTA CTGTATCAATGGCGG[C/T]TTCACTCGACACCCC TCTTGAAGTTTGCGTCAAACAATCAATCACAACTC
solcap_snp_c1_11100 PGSC0003DMB000000505 241200 ATACATAGATCATATATCGCTCCAGTACTACAACT CATCTTAGACTCCGA[C/T]AACATTATAACATAA GTAGAGAAATACAAAATACTTAAAACATTACATCA
solcap_snp_c1_11117 PGSC0003DMB000000505 141248 TTTAGAAAACTTGGAAAATCTTGATGCTAGAGGTA CTCTAATTTCACAAC[C/T]TCCATCTTCCATTGT CCAGTTGAAGAAGCTTAAATTTTTGAGTTTTGCAA
solcap_snp_c1_11117 PGSC0003DMB000003720 227 TTTAGAAAACTTGGAAAATCTTGATGCTAGAGGTA CTCTAATTTCACAAC[C/T]TCCATCTTCCATTGT CCAGTTGAAGAAGCTTAAATTTTTGAGTTTTGCAA
solcap_snp_c1_11120 PGSC0003DMB000000316 555132 TCAAGATGCCAAGATTGCATTGTGTCTTCATTGTT TTGGAAAACGATTTC[G/A]AGGAACTCATGGAGA GAAGATGGCAACACAGCTGTAGCTAGGTGTGGAGA
solcap_snp_c1_11121 PGSC0003DMB000000316 555073 ATGGAGAGAAGATGGCAACACAGCTGTAGCTAGGT GTGGAGAATCAGCAG[T/C]GGGAGCACTTCGAAT GGAATCCAAAGTGAACACCCCGGGGATGTTAAAGT
solcap_snp_c1_11122 PGSC0003DMB000000316 555067 AGAAGATGGCAACACAGCTGTAGCTAGGTGTGGAG AATCAGCAGTGGGAG[C/A]ACTTCGAATGGAATC CAAAGTGAACACCCCGGGGATGTTAAAGTGATCAG
solcap_snp_c1_11123 PGSC0003DMB000000316 555030 TCAGCAGTGGGAGCACTTCGAATGGAATCCAAAGT GAACACCCCGGGGAT[G/A]TTAAAGTGATCAGCA AGCTTCAGAGGAGTGTCAGGATGAATGTAAGAGAT
solcap_snp_c1_11124 PGSC0003DMB000000316 445728 CTTGATCATTTCGGTCAGAGAGAAAAGCCTTATAA GCCAGCGGTTGGCTT[T/C]TGGCTGCTTCACGGA GCGAAATACCTTGAAGATCTCCGAGATGTCTCTCT
solcap_snp_c1_11126 PGSC0003DMB000000249 367373 AAGTTCAGTCAAAATAATCAAGATATCTCACAAGA GTTCCAGCTTCCATC[C/T]GCATATGAATCTGCC ATGGAAGCTCTTTCGACTCTCATTACTCAGAAAAA
solcap_snp_c1_11135 PGSC0003DMB000000249 456771 ACCACTGTCAGTCTACATTCTGGCCTCACCATCAT TCCACACTTTCCTTT[A/G]GCATGGTAGGACAAC CTTTTCTTAAAGAGTCCCTTCCCAAGAAATGCCTC
solcap_snp_c1_11137 PGSC0003DMB000000575 202083 AAATATACAGAACTCATACAAGATGTATAGTCAAT TTTCTTGGGGGAACA[A/G]AAGGGGCAAGTGAAG TATGAAGAAAGCATTTTGTTCTAACAAAGACAACA
solcap_snp_c1_11139 PGSC0003DMB000000575 216827 GTTGATGCTGTGCACTAGAGGGATCCATCACTAAG TACAGCTAGAAACAA[T/C]ACAAAACTTAGAGCT TAATTAAAACTTAATTAATCCTCCAAGATGGTTTA
solcap_snp_c1_11144 PGSC0003DMB000000801 47671 AGAGACATATACTCATAGACTAATAGCCTCTGATC TCCCTCAGCACAACA[A/G]CCAATTAGTTTAACA AGATTAGCATGGTCAGCCTTACTTAGTGTCTGTAC
solcap_snp_c1_11150 PGSC0003DMB000000056 1881707 CTCGAACCACAAGTCGATTGGAGATGCGTTTTGAA CCAATTTAATTGATT[C/T]GAAAGCGGAGTGTTC CATGTGGGTAACCGGATGTTACGTGCAGTCCAGAA
solcap_snp_c1_11196 PGSC0003DMB000000671 204057 CAAGATGGAGTCCAGTCAGTGGTGAATCGTGCTTT GCTAAGTCTTCCTGC[A/G]CACAAACATATTAAC TTTATCACACAGACAGCTATTCTAGAGTTCAAGTG
solcap_snp_c1_11202 PGSC0003DMB000000836 91302 GAAGCTCCATTTAGTAACTTCAAATTTGGGCAGAC TCTTACTGCAAGGAT[C/A]ATTTCAAAGCTCAAT ATGTCAGAAAGTGTTAAGAGAGGCTATCAGTGGGA
solcap_snp_c1_11206 PGSC0003DMB000000164 1043090 CGCTCGACGGAAGTTCTCCACATCCCAGACATTAA GTAAAACACGTCAGC[C/T]TTGGCGGCATCAGCT TTCATGCGAAAGAGATTGAAATAGTGGCTTAAGAC
solcap_snp_c1_11210 PGSC0003DMB000000164 921429 AGACTTGATTCAGATCTTCAATATCCGTGTACCCT TTAAAATTCTTGCAG[T/C]AAAACCTTATGAATT ATCACTTACCTAAAACCACAAAATAATTAATCAAA
solcap_snp_c1_11211 PGSC0003DMB000000164 921428 TAGACTTGATTCAGATCTTCAATATCCGTGTACCC TTTAAAATTCTTGCA[G/A]TAAAACCTTATGAAT TATCACTTACCTAAAACCACAAAATAATTAATCAA
solcap_snp_c1_11237 PGSC0003DMB000000353 393477 TTGACATTAATGCTGCCACAAAGCATGGCATTAAG GTCGCCAAAATCCCA[G/A]GTGGTGCAACTGGAA ATGCTGCTTCATGTGCTGAAATGGCCATATATCTC
solcap_snp_c1_11239 PGSC0003DMB000001091 26839 ATTCTTGACAGTGTACTCACTTGGAAACAAAATTG AATAATCATGAATAA[G/A]CTTATTTAGGTAGTT CACCAGCGCAGGTGATTTACCTAGTTTCCGGAGAT
solcap_snp_c1_11242 PGSC0003DMB000000322 21747 AAAAAGCAACGCTAATTGCCATCGTTCTACAGCAC ATAGCTATAACAGAT[A/G]CCTATCAGTCTATCA CTACTTCTCTAAACCAATAAACACTACAATGAATA
solcap_snp_c1_11243 PGSC0003DMB000000322 21799 GACTGAAGAACAATCATATTCTGCAAACAATGTTT CACACTGGCATCATA[A/T]TAAAAAGCAACGCTA ATTGCCATCGTTCTACAGCACATAGCTATAACAGA
solcap_snp_c1_11246 PGSC0003DMB000000324 131408 TCATACTCAAGAACGCGCATAACTGTTGCCTCAGC TTTTGAGATGATATC[T/C]TCTGGTGACTTCTCA AGACGACGATTAGCTATGTTTTGAAGAGTATGGCA
solcap_snp_c1_11247 PGSC0003DMB000000324 408122 TGGAATCCATCACACATTGGAGATGGTTCAGTTAG ACCTAACGATGGAAA[C/T]GGTGCTGCTGCATCA ATTTCTGAAGCTGGTAGCAGTATCACCAGGCTCGC
solcap_snp_c1_11259 PGSC0003DMB000000210 835493 AAATTATATTCCATCATTCAACTCCATTTGGCTTA AATAACCTAAAAACA[T/G]TGTCTTTAATTTTAA AAAAACTGCAATAATAATTATAGGGAGTTGTACAC
solcap_snp_c1_11265 PGSC0003DMB000000210 629561 CAACTTCAATGCTCTTGTATTCATTAGGGGAAGCC TTAGGGAACAAATTT[G/A]TTGAGTCCCTAATGC CATTCCAAAATTTGTCTACTGGAGTTTTCACCTCA
solcap_snp_c1_11267 PGSC0003DMB000000210 915095 CATTCCACTGTAGAACAACTACATTACGGTTAATC AAAATCCAAAACTTA[C/A]TCAGATAGCTTTAAT GGTAAATAGATAATAATAATAATCCCTAAACCGAA
solcap_snp_c1_11275 PGSC0003DMB000000461 82360 TTAGTGTTCAGTAGCTCTTTGATGTCCTCTCTCGC ACTTTTCAACTGATC[G/A]GGATCAGAGGCAGCT GATTTAGCCGATGCTACAGTACTGAAACTTCCACT
solcap_snp_c1_11276 PGSC0003DMB000000461 115932 TGCAGCATCAAGGTGGGAGGACCAAGGAAGACATT ATTGACTTTATCCAG[G/A]AGAATCGGGATAAGG CTGCAGAGCAAGCTCCGGGAAAAGATGAGCTATAA
solcap_snp_c1_11288 PGSC0003DMB000000290 722240 ATAGCTTTTCTCCCTGATAATAGTTCCAGCAAAAC CACTCCAAAGGAGTA[G/T]ACATCAATCTTATCG CTAACTTTCCCATACATAAAATACTCTGGTGCTAG
solcap_snp_c1_11290 PGSC0003DMB000001012 21233 ACATTGTGTTCTGCAGAGAGCTGAATCGCAAGAAC CTCGCCAGTTGATCT[A/G]ACAAGTCTCCCTAAG ACTGCCCTCGAGTCACCAAGGTTGGCTACATATAA
solcap_snp_c1_11308 PGSC0003DMB000000290 827584 AACATAATTGAGGAAAGCACCTAGTGAAGAAGCCT TTAGCTTCTTCCTCA[A/G]TACCATAGTCAGCCT CACAGCTCTCGAAATCCTCCTGACCTCACGAGCAT
solcap_snp_c1_11319 PGSC0003DMB000000008 632040 TTATCTCTAATTTTTAGTTCAATTAAGTATGGCAG GAACAAGTAATTATC[C/T]TCCTCAAACTCCGGC GCCTATGCCGGTACCAAATCAGGTAGCAATTATAA
solcap_snp_c1_11329 PGSC0003DMB000000008 587699 CGACACCTCACCAAATTACTGTACCTGGAAACTGA AGGCTGCCCAGAGTT[G/A]GAAGAAAGTAGCACC AATCGGAGTAGCTCAAACTCCCAGTGGCCCAACAT
solcap_snp_c1_11339 PGSC0003DMB000000533 194679 GCGGATCTCAAGCATATCCTCACCAGTATAGGTGA AAAGCTCGAGGCTTC[A/G]GAGTTCGATGAGTGG ATCCGAGAAGTTGATGTTGGATCAGATGGAAAGAT
solcap_snp_c1_11344 PGSC0003DMB000000085 799211 ATGGGAGTCTGCTACCTTGGCTATCAAGAGGGATG GTTATAGCATCAAGG[C/T]TAATGGGCCTGGTGG TGTTCTCGTCAGTGAGAAGTTTTCTCAATCTACAA
solcap_snp_c1_11350 PGSC0003DMB000000271 435973 CTGGAAAATCAGTATGGATTCCAGATCTTGAAAAG TGGGGTTTAATGGGT[C/T]CAAATTATGATTACT ACGAAAGGGGTAATGTGGATATCTTCACTGGTAGA
solcap_snp_c1_11351 PGSC0003DMB000000481 273297 TGGTTCTTGGCCGAAAAAGAAAGAGGCGGAGGGAG GTGCTGTTCTCGGAG[T/C]TGCTGGTCGCTGGTG TTGATGTCTGGTGTTGCTGGCAGCTGCTTGGTGTT
solcap_snp_c1_11352 PGSC0003DMB000000285 600876 GACAAGGAATTGCAACCATGGATTGCCAAAGATGA TGATCTTGGTCAGAA[G/T]ATGTGGAGGATAAAC CAACGAATTGTGAAATTGATTGCAGAAGTAATGAG
solcap_snp_c1_11356 PGSC0003DMB000000285 634749 GATGATGGTGAATCAGATGATGAGTTTGAGAGTGG GAATGAAAGAACATG[T/C]TCTTGCAAGATAATG TAATTTTAGCTCCTTGTAGAAGGTTTCGTGGGCTG
solcap_snp_c1_11362 PGSC0003DMB000000285 692205 GAATCGACAAGGGCTTTTCACATCCGATCAAGATT TGTATACGGATAGAA[G/A]GACTCGAGGGATCGT TACGAGTTTTGCTATCAATGAGTCACTTTTCTTTC
solcap_snp_c1_11363 PGSC0003DMB000000285 692366 TCTTTCACAGAGAGACTTTACCCTAATCAAGATTC ATCCATGGATAAAAC[A/C]TTTGCCAACAACCTT AAAATAACATGTCCCACTACAAACTCCACGAACAC
solcap_snp_c1_11364 PGSC0003DMB000000285 692378 AGTCATTGTACTTCTTTCACAGAGAGACTTTACCC TAATCAAGATTCATC[C/T]ATGGATAAAACATTT GCCAACAACCTTAAAATAACATGTCCCACTACAAA
solcap_snp_c1_11365 PGSC0003DMB000000285 694993 ATGGATTCAGCATTGGGACAAATGGAGTCATAAAA AGTCCATGAAAGACC[T/C]TTCACAATTGGTTGA GTACCTTGAGCTTTTGTTACTTGAAAATGGATTGA
solcap_snp_c1_11391 PGSC0003DMB000000285 579460 GAGATTCTACGAATTTTGACACATTACAACCGTCC GATCTACAAAGTTGT[G/T]CAACAGGGTGGCGAA GCAGACAGAAGCAGCCGAGGAATCCATGCTTCAAC
solcap_snp_c1_11406 PGSC0003DMB000000366 168422 TTCAAGACAATGTTCATAACCACACTGACTTGGGA AAGAAACTAGATAAA[A/C]ATCTGCCTGCATCCA GTATCAACCCGCAAGAACTCTTCCAGTGCCTTAGG
solcap_snp_c1_11418 PGSC0003DMB000000052 2063193 AGGATCGAAGCAAATCACGATTCATAGTGAACGAA AATGGGGAAGCAACC[G/A]GTGAAGCTGAAGGCT GTTGTATACGCTTTATCTCCATTTCAACAGAAAAT
solcap_snp_c1_11442 PGSC0003DMB000000162 550237 TTTTATCCTTCTGCTTCTACAAGAGCTTATTTGCT GGTAATGGCTCAGGT[T/C]CTTGTGAACTTGACT TCATAGTGCAGTTCATCGCGTCTCGAGTACTAGAC
solcap_snp_c1_11458 PGSC0003DMB000000004 3499538 CAATCAAAAGATCTTCATTTTTTGTTCCCTCGACT GATGGTTATGCTCGG[G/T]CTGCCCTGCGATGGA TTGGTCATGAGCCAAGGTGCACACCTTACTGGCCC
solcap_snp_c1_11459 PGSC0003DMB000000004 3499550 CAAAAATGGCGTCAATCAAAAGATCTTCATTTTTT GTTCCCTCGACTGAT[G/T]GTTATGCTCGGGCTG CCCTGCGATGGATTGGTCATGAGCCAAGGTGCACA
solcap_snp_c1_11473 PGSC0003DMB000000161 1173089 GATGATGGCTTGTAATCTCTTTTTTATTCAAAGCA CGTTGGCCGGAGGTC[G/T]CTGCTGCTGGTTCGC CGTCTCCTCACAGGTCGGAGTGGCTATTTGGAGCT
solcap_snp_c1_11475 PGSC0003DMB000000413 126590 ATGGACTCATCAAGGAGCTTTGAGGCTGGAAATAA TGGAAGGACGATTCC[C/T]CCCCAGGAGGCATGC AACCGAATTGCTGCAGTGGTACAAGAAGCAGTGCA
solcap_snp_c1_11479 PGSC0003DMB000000413 98651 GAGATTTTGCTATATCTGCAGCCTCAGCACGATGT TTGAGCTCCATCATT[T/C]CCTGATACTGACCCT CAACTTCAGCAATTCTGTTGATGGCAGCATGGAAG
solcap_snp_c1_11485 PGSC0003DMB000000413 190060 GTGGAACAGAGGATGCGATTTGCTTCTGGACACTT GGCTTATATCCATGC[C/A]ATGGAAAGAGTTTCA GCTGCTCTTCGAGATTATGTTGAAGTCGATGAACC
solcap_snp_c1_11491 PGSC0003DMB000000241 364601 AACCCACCTCTTACGCTGCCTGTTGTATTAACCCG CTTGAAGCAGAAACA[G/A]GAGGAGTGGACAAAG TGTCGCTCAGACTTCAACAAAGTGTGGGCTGAAAT
solcap_snp_c1_11494 PGSC0003DMB000000241 468595 GACCATCCTTCTATAGTTTGTCCCTGCATACAGCC AACGAGTACGAAAAG[C/T]TGTCTCCTCTCTTTG TGGCATTTTCTCTACTTCTGCAACCATTGTTTTCC
solcap_snp_c1_11495 PGSC0003DMB000000241 142557 TTAGCTAGTTGAAGCAGAGTGCACAACATGGTGTA ACAGGATTCATACTT[A/G]TGGTAACATGTTGGT ATTGTGCAGTCATTACCGTGGTTTAATCAATTTGA
solcap_snp_c1_11498 PGSC0003DMB000000241 142347 TACTTCTCCAAGGGAGCTTTTTGGGTTTCAGATGT TCTGAATCGGGCTGC[C/T]AAGGTCGCTGCTGAC TTGGGTAACAATGGTGTCAAAAAAGAAACAGTTCC
solcap_snp_c1_11499 PGSC0003DMB000000241 142293 TCTTATACAGGGAAAACAGCCGTAGCTGCTGCAAC CGCTGTGGTTAGCAG[C/T]AGTTACTTCTCCAAG GGAGCTTTTTGGGTTTCAGATGTTCTGAATCGGGC
solcap_snp_c1_11502 PGSC0003DMB000000241 141176 CTAGATCAATGTGTTCGTATATCTCGCTTGGAAGC CCATGTAGATGAAGA[C/T]GATCCTTGGAATAAC TATATAGATAAGGTGGAGAATGGAAGCAGCTCTGC
solcap_snp_c1_11506 PGSC0003DMB000000730 148760 TGAAAAGTAGTATGGAACTGTTTCGCAGTAGGAAA AAGTTTTCTTTGTCC[A/G]TTGTGCTCATGTCCT GTCGTGTTTTAATTTAATTTGGGCTGTACAATTGT
solcap_snp_c1_11509 PGSC0003DMB000000651 61483 CTTATAGATACTGATGATTCTTACACACAACCAAC TGGTCGGAATATACG[T/C]AAAGCTTTATCGGAT CTTGTTGGATCTGCTGAATCAGGGGATTGTTTGTT
solcap_snp_c1_11517 PGSC0003DMB000000651 63530 TGAAAGTCATTTTTAACAAGCTACAAAAGAATAAC GAGCAGGGTGGAGGC[A/G]GTGGGTTCATGGGTA TGGTTGGTAACTTGGCTCAAGAGTTTCTGAAACAG
solcap_snp_c1_11519 PGSC0003DMB000000047 1815446 GCTGCCCTGCATATGGTGCATTGCTTCCACTTAGC TGGATTCCCTAAAGG[C/T]CTTATCAGTTGTGTG ACCGGAAAAGGTTCTGAAATCGGAGATTTTCTCAC
solcap_snp_c1_11520 PGSC0003DMB000000047 1815428 CATTGCTTCCACTTAGCTGGATTCCCTAAAGGCCT TATCAGTTGTGTGAC[C/T]GGAAAAGGTTCTGAA ATCGGAGATTTTCTCACTATGCATCCTGGAGTAAA
solcap_snp_c1_11521 PGSC0003DMB000000047 1814414 GTTGCATCTTTCTCCTTTGCGTCCATGACCAACCC CTCGATGAAATTCGC[A/G]GATGACTCGGAGACA ACTGGAGTGATATCACAATTATCTTCGGGTGGCCC
solcap_snp_c1_11523 PGSC0003DMB000000047 1814267 TTGTTAGACAATGTTAGGCCAGACATGAGAATCGC TTGGGAAGAACCATT[T/C]GGTCCAGTTTTGCCC GTTATTCGGATCAACTCAGTCGAAGAAGGAATTCA
solcap_snp_c1_11525 PGSC0003DMB000000047 1633291 CGCCGGTGATGCCAATCATCTGTCCTTTCTATGAA CACAGAAACAGTAGA[A/G]TGTTGTATAATGCTA TCATTTTATTTTTCACTTTTTCTCCCCCCTTCAAT
solcap_snp_c1_11534 PGSC0003DMB000000047 1818924 GAAGTGTACAAATATTATTGTGAAGGAGAATGGAG AAAATCAGCTTCTGG[A/G]AAATCTGTTGCTATT ATTAATCCCACTACAAGAAAAACACAATACAAAGT
solcap_snp_c1_11535 PGSC0003DMB000000446 207689 CTAAGCCCTTGATGTGATCATCGAAACATTGTCTT GAATATGAGGTCTGA[G/A]CTATCAGCACTCTTT CGCGTTCATGTCGTTGTTTCATCCATATTTTCTGT
solcap_snp_c1_11539 PGSC0003DMB000000446 314108 GTGAAATGAACCTTGGATTTTTCTGAAGAGATGGC AGTAACTTTTACCCA[T/C]ACCATCACCTTTGTT TTCATTCCTTCAATCTCGACTAGCTTTCCCTTTTC
solcap_snp_c1_11540 PGSC0003DMB000000446 314063 ACCCATACCATCACCTTTGTTTTCATTCCTTCAAT CTCGACTAGCTTTCC[C/T]TTTTCCAGATATCCA GTAACAGCTGTAGAGAAGCGTAATACAGATGAATC
solcap_snp_c1_11544 PGSC0003DMB000000406 223803 GAGTCAGTAATAGAACCCTGCTGCTGCTGATACTC AGAAAATAGTACAAA[T/C]ACTTTGCTCTGGGGG GTTCCTTTAACCCAGCCATCTCTGAAATGACCCTT
solcap_snp_c1_11546 PGSC0003DMB000000406 223551 CTATCAAGAAGACGCAAAATGACTTCTTGCTCCTC TCTGGTAAGACGAGC[C/T]CTTAGCCTAGCTAGT ATCTTCAGATCACGAAGCCTCAAATGATGCCTAGG
solcap_snp_c1_11552 PGSC0003DMB000000406 123295 CCACTTTTAGAAATTTGGAAGGAAAAATCTAACAG TAATGGAGAGTCCTC[C/T]GTTGTACTCGAGTCT TACTCTCCACTGGAAGCTGTATCAGTGTATGAGTT
solcap_snp_c1_11553 PGSC0003DMB000000406 98414 ACGAGAGTGCAGAAATAATACGCATGTTTAATAGT GAATTTAATGATATA[G/A]CTGAGAATGCAGCTT TGGATCTTTACCCTCCTCATTTGCAATCCCAAATA
solcap_snp_c1_11554 PGSC0003DMB000000406 98410 AACAACGAGAGTGCAGAAATAATACGCATGTTTAA TAGTGAATTTAATGA[T/C]ATAGCTGAGAATGCA GCTTTGGATCTTTACCCTCCTCATTTGCAATCCCA
solcap_snp_c1_11556 PGSC0003DMB000000406 281089 ATCACTATGGTGGCCTTGAGGAGAAGTATTGCTTA GTTCTTGATTTTGTT[T/G]TAAATCCTGATCTTG TGACAATCCTGACCCCATTTCTCTGAAGAAGAACT
solcap_snp_c1_11559 PGSC0003DMB000000225 318861 CGCTTCCCTAGTTGGACTTCAACTTCTGTACCGAA TGAAATATTGCTGGC[C/A]AGTGACTTTAGAGGA TCAACACTGGGATCAACAGAAAGCAAGTTGGGTAT
solcap_snp_c1_11562 PGSC0003DMB000000225 197282 AAAATGGCATTAGATTGTTTTTTTGCAGTGTGGTT TGTGGTTGGCAATGT[A/G]TGGATATTTGGTGGA CACTCCTCTTCCTCTGAGGCTCCCAACTTGTACAG
solcap_snp_c1_11572 PGSC0003DMB000000021 240245 TTGTTAGCAAAGTCAACTAGCGGCTTTGGCACGCT GAGGGTCAGTGGCCT[C/T]AGCCTTGTTCCAAAA CCTCCTACAAGGATGAGTGCCTTCATGATGAAAAC
solcap_snp_c1_11575 PGSC0003DMB000000848 74466 CCTTGAGTTCATTTTCAAGAATTTTCAACATCTCA CAAGCTTCCTTTTTT[G/T]CTTTCTCTTGTTCCT CTCCTTTCAGAAAGATAGTTTTCCCCACTGCTGCC
solcap_snp_c1_11581 PGSC0003DMB000000386 231148 TGCCAAGGTGATAAAATTGACTGGCTCCAGGCCAG CAATCAATCCTATAT[C/T]TAAGGAGCCTACTGG TTTGAGGTTTGCACTAGTTGAAGTGACTGCATCAT
solcap_snp_c1_11596 PGSC0003DMB000000386 54020 ATTGAAGTCCGAACTAGCCTTCGTGTGGAGCGTTC AAGTAGTCCTAGGTT[G/A]CCTCCAGGAAGATTG CCAGAGACTGTTCGGTTCTATTCGGGTGAAAGGCC
solcap_snp_c1_11612 PGSC0003DMB000000021 1647744 TTCATTTGTAGTACCATCACCATTTAGCCAAGGCA ATATTGGCTTACACA[G/A]ATGCAAACCAGTAGA GCGGATATCATATGGTTCTTCTGGGTGATTTCTTG
solcap_snp_c1_11612 PGSC0003DMB000000190 1105349 TTCATTTGTAGTACCATCACCATTTAGCCAAGGCA ATATTGGCTTACACA[G/A]ATGCAAACCAGTAGA GCGGATATCATATGGTTCTTCTGGGTGATTTCTTG
solcap_snp_c1_11613 PGSC0003DMB000000021 1647672 ATCATATGGTTCTTCTGGGTGATTTCTTGTGGGTG AACTAGCTTCAGTAG[G/A]CCGACAACCTTTTGC CTCATTGATGGTTTGCTTTTTACTTGAAGGTTCAG
solcap_snp_c1_11613 PGSC0003DMB000000190 1105277 ATCATATGGTTCTTCTGGGTGATTTCTTGTGGGTG AACTAGCTTCAGTAG[G/A]CCGACAACCTTTTGC CTCATTGATGGTTTGCTTTTTACTTGAAGGTTCAG
solcap_snp_c1_11626 PGSC0003DMB000000322 408202 GATGATGTCATGGTTTGGTATTGAGTAGCAAACTG GGGAGCATGAGCCTG[A/G]GAGTAGTATATTTGT GCATGTGTAGGATCAGAAAATTCATATGCATAATT
solcap_snp_c1_11639 PGSC0003DMB000000404 380505 GACTATACAATGCCGCTGGGACTGTTATTAGGTTT AGGGAGATCTTTCAG[A/G]AGAAAGCGTACTTCA TCTCTTGATATTCTTACTACAAAAAAGGTTCCTCG
solcap_snp_c1_11644 PGSC0003DMB000000477 39138 TCTTCCACAAACTTCAATGGAACTCTCTTCTTTGT CTTCATATCATACTT[C/T]CCTAGAGCAGCACTA CTCATCATCTTTACACTCCCTCTTCTACGTCTTTC
solcap_snp_c1_11657 PGSC0003DMB000000477 184838 TTATTGTGAAGGAGTGATGCAAAAGCAGCATATAG AGAGGCAGTATACAT[A/G]TTGCCAACTTGTTTT GGTATTAATGTGGTAGGTTGCACCTTCTCATCGTA
solcap_snp_c1_11667 PGSC0003DMB000000477 99982 GGGTAGGTGCACCGATTGGTAATGTCAAAAGTGGC AGCATGAGTGACATA[T/C]AAATAGTATTGACCA AAATAAAGGAAGACAAAAAGGGGGAAAAACTTGAG
solcap_snp_c1_11668 PGSC0003DMB000000477 99949 GCAGCATGAGTGACATATAAATAGTATTGACCAAA ATAAAGGAAGACAAA[A/G]AGGGGGAAAAACTTG AGGAAATGCATTTTTTTTTGTGTTGTTAAACTTGA
solcap_snp_c1_11670 PGSC0003DMB000000517 287140 ATCGTCATTAACTTCCCATGGTTCATAGAGCAAAT CAGCATTAAAGGAAC[G/A]CACAGATATACCTTG AGCTGTTAAGATTTCTTTTGTGCGATGATCTCTCA
solcap_snp_c1_11707 PGSC0003DMB000000772 127145 ATGAAAGGTCTCTTTTACTGTGTGATTTACTTGAG TCCTGGAGATTATCA[T/C]CGCATACACTCACCA GCTGATTGGAATGTTTTTGGCCGTCGACATTTCTC
solcap_snp_c1_11709 PGSC0003DMB000000086 799338 GCTGCTACCGGAGACTCCAAAGTTTTCTATTTGAA AATGAAGGGAGATTA[T/C]TACCGGTACTTGGCT GAGTTCAAAACCGGAACCGAGAGAAAAGAAGCTGC
solcap_snp_c1_11710 PGSC0003DMB000000086 799368 AAGTTGCTTGATTCAAAACTCATCGGGTCAGCTGC TACCGGAGACTCCAA[A/G]GTTTTCTATTTGAAA ATGAAGGGAGATTATTACCGGTACTTGGCTGAGTT
solcap_snp_c1_11719 PGSC0003DMB000000135 182558 AGAGACTATCCAATGGATCTTCAATCTCAGGCCCT TGAAGCAGTCAATCT[G/A]TCTCCAAGAGTTAAC TTGTCTCAGCCCAAGAACTGTTATCCAATCCCTTC
solcap_snp_c1_11722 PGSC0003DMB000000086 749648 ACCTTGATTTTATTGTCAATTGTGTGATGACAGTA GAAAACCGCGTAAGG[A/G]CTAGACAATAGATGA CACGCCACCATTTTAGGAGTGGTAATTTGTTGTGG
solcap_snp_c1_11723 PGSC0003DMB000000086 749575 CCATTTTAGGAGTGGTAATTTGTTGTGGAGTGTCT AAAATTGTATAACGA[C/T]GAAGCAGGGGAGAAA TATCATGAGTTGTTATCGTTGTCAGAGCTTTGATT
solcap_snp_c1_11725 PGSC0003DMB000000116 1554444 TTCATTTGGTCTGCAAAAGGATGATTAATTCCAAC AGAAAGAGCTAAAAT[C/T]CCCCCTCTTCCTACT ACTACTACATACTCCAACAAGCATGGAAGAAAAAC
solcap_snp_c1_11730 PGSC0003DMB000000063 115562 GTTCTTTGTACTTACTTGAAAATCCTCTTCGACAC CGCCAATCTTCTGAC[C/T]GCACCAACAATTCCA ACAACCAACACATTCTTCCATGAAGCATGGAAGAT
solcap_snp_c1_11750 PGSC0003DMB000000294 311844 GTAGTTATGATGACGTTGAGGAGATCAAAAAGCTC TACGCTGCTGAAGAG[C/T]AAAACTGATAGATGT ATCTATACCATGTAATCACTTCACTACTCTTGCTG
solcap_snp_c1_11758 PGSC0003DMB000000294 103004 GAGCATCTGCATCTTTCACAAATTTTGGGAGATCT CTTTTGAGTATGCGC[A/C]GAGATCAGGTGCATT CCATGGAAGCTGCTCATGAGGCGACTAGCCAAGAG
solcap_snp_c1_11769 PGSC0003DMB000000095 1375195 TCTGAAGTCTCCCAATGACCAGAGATCACCAAAAT TGAATTGGGTTTCTG[G/A]GTGAAGACTTTCTGT TTGAAGCATTTCAAGAAATGTCTGGCAGGTAAGGA
solcap_snp_c1_11773 PGSC0003DMB000000095 1478074 TGTATCAGCATTACTTCTGTGATTCTATTTGTGTT GCTCAATTTATGCAC[A/C]CAGGCATAGTCTTGC AGCATGGACCAATATACCCGGTAAACGGAAGAAGA
solcap_snp_c1_11777 PGSC0003DMB000000263 247457 GTCCACAGCATCAAGCCAATATTTGAATGAAAACC ATGAACCCTGGTGTA[C/T]AGATCCATTGCCTAA TTTCCTTGATTATTCGATGAATAACCCTGTCCAGA
solcap_snp_c1_11778 PGSC0003DMB000000263 247420 GAACCCTGGTGTACAGATCCATTGCCTAATTTCCT TGATTATTCGATGAA[T/C]AACCCTGTCCAGAAT AGTCAGGTAGCTTGTAGCGATAAACAAAGTGATTG
solcap_snp_c1_11787 PGSC0003DMB000000185 390895 GCAACATCTTCTTCAAGTGATTTCTTGTATCGAGC ATGGTAGGCCTGCCT[T/C]GCCTTAAAAAGATCA TCAGAAGACCTGGTACAAGCAGTTTCCATGATAAC
solcap_snp_c1_11791 PGSC0003DMB000000185 394608 AACCTATCACACTTACAGAAGTGGCAAAACAGAGA GAGTTGAGTGGAACA[T/C]TAGAAAGTGATTCAG ATAGCAACATGAAGAAGCAGCTGTCAGATGCAAAG
solcap_snp_c1_11801 PGSC0003DMB000000267 119940 AGAGGAATTTAGAAGGTGTAGGCAGAAGCATCCAT AGGGTGAATAAGATA[A/G]GTAAGAACTAAAGCC AGCAACATCAACACATACGCAATTCCTTGATCAAT
solcap_snp_c1_11802 PGSC0003DMB000000267 122157 TCGGTGACACAGGATCAGTCAACCACAGAGACTAA CTTTTCCTATGGGCT[T/C]CAGTGGGAAATGGCC CAAAAGTATGCACCAAATTACCAACTTTTAATATT
solcap_snp_c1_11804 PGSC0003DMB000000267 122298 TTATGCTCCAACATAACTAGATAAATAAGTATCTG CTCACAGCACAAATC[A/G]ATCGAGGGAGACATC AACTCACAAAAGAAATCTGCAACCATCTCATTACC
solcap_snp_c1_11806 PGSC0003DMB000000267 281401 ATGCATCTTACCACGAATATGACAAAGACGTTTAG TACCATCAATACAAG[C/A]AGCTTCACATCTTCC ATTACCTAACATACGTTGTATCTGAGCGTATTCTT
solcap_snp_c1_11807 PGSC0003DMB000000267 281498 TCTTGTCCATCTTCTTTGAAAATTAGTTCTCTCCT TTCATCATCAGCTTC[G/A]TTCTTCCCTCTCTTC CTGTTCTTACCTCCCTTTCCCTTGTTCTTCGGCAT
solcap_snp_c1_11810 PGSC0003DMB000000267 298025 CTTATAAGGCAAATTGTGCTTTTTGCATAGCTCCT GCACAATAGGAGAAA[C/T]TTTCCTCAGTTGGCA CCTTGGTAGCCTTGGAAACAGATGATGCTCAAGCT
solcap_snp_c1_11815 PGSC0003DMB000000017 2354817 TCATCAGCCTCGCCAGGGAATGTAATTTTCTGTCC ATTCTGCATTCCTTT[G/T]TCAACATGGACTTCA ATGACTTTCTTCTCCTGTACCACTTTTTCACCTTT
solcap_snp_c1_11840 PGSC0003DMB000000142 148850 CTTCCGTTCTCGATAATTGTAAACCGGGCTCTTTT GTTCATAAATGCTTC[G/A]AAGATGCTGATGATC AAACTGTATCTGATATCACGTTGCTGACTTGCCGT
solcap_snp_c1_11853 PGSC0003DMB000000020 2619971 AAATGGTTACTATAGACAAGCTCCTCGGCAAGAAA GAGCTTACCCTAGCA[A/G]TCAGCAAAGCTTGAG AAATGAGCAGTACTCATGGGAATAAGCTGAAGTTG
solcap_snp_c1_11866 PGSC0003DMB000000020 2695547 GTATCGCTTGGTTGCGATACACTTCCAGTTCTTAA AGGAAGGACTCCTGT[C/T]CAATGCTATTCTGAT TTCATGAGAGGGTTTAGAGATAGATTTGAGAATCT
solcap_snp_c1_11867 PGSC0003DMB000000020 2694529 GATAGTGTGAAAATGGATCATACTGTGAATAGGAA GAAGGCGATGAATGC[G/C]AGTTTACAGGCGTTG AAGAGCGCCGGTGTGGAAGGGATTATGATGGATGT
solcap_snp_c1_11868 PGSC0003DMB000000507 266766 GACTCTGTTGGTTGAATATCACTCCACTCACCATT TTCAATTGACTGATG[G/A]TTCGTTTGATCTACT GTTAGATCAACTACATTCTCTGGAGGCACATGATC
solcap_snp_c1_11870 PGSC0003DMB000000507 268174 CAATAAAAGAGTTAGCAGATAAACTATCTGAAACC GCTGAAGCCGCAGAG[G/A]CTGCTGCATCTGCAG CTCAAACTATGAATGAGCAAAGGAAAATTGCTTGT
solcap_snp_c1_11892 PGSC0003DMB000000083 1416939 ATTGTAGCAAGAAGATTCCCAAAGATTAAGAGTGT TACCCTTAAAGGGAA[A/G]CCAAGATTTTCTGAC TTTAATTTGGTACCAGAGAATTGGGGTGCTGATAT
solcap_snp_c1_11898 PGSC0003DMB000000263 638999 AATTTGGACTCCGTAATGGAGACAGTTACCCTGAG CTTATCTTTGAACCT[T/C]GGTGTACATGAGATG CTTGAAGCAGAATTCCATGTTCGAGTTGCTGAGCA
solcap_snp_c1_11900 PGSC0003DMB000000263 638979 CAGCTTTAGGCTTCATGGTTAATTTGGACTCCGTA ATGGAGACAGTTACC[C/T]TGAGCTTATCTTTGA ACCTTGGTGTACATGAGATGCTTGAAGCAGAATTC
solcap_snp_c1_11907 PGSC0003DMB000000263 827585 GACTGCTGGACACATAAAGAAGCAGCTAAGACCAT GAGGTTCATCTGTAG[T/C]AAGTCGTAGTCATCC GCAAGTGAAGGATCAGCGAGTTCTCTGATTCTGTT
solcap_snp_c1_11920 PGSC0003DMB000000303 550026 TGCAATGGACACAAAGCTATTAGAGGCGCTTTATT GGAAAGGAGTGCCAG[T/C]TTTTGATATGGGTAG CCATATGAGCACTGTAGATGTTGGATGGGGCTCAC
solcap_snp_c1_11921 PGSC0003DMB000000085 1292327 AGGTCCAATACGATGGGATTACGAGGAACTGGTTG GAAGGCAGGTGGAAA[T/A]GTTTCAATTCGAGGA ACAACCTTCATGTTGGCTTCACCAACAGCTGATTC
solcap_snp_c1_11921 PGSC0003DMB000000268 625277 AGGTCCAATACGATGGGATTACGAGGAACTGGTTG GAAGGCAGGTGGAAA[T/A]GTTTCAATTCGAGGA ACAACCTTCATGTTGGCTTCACCAACAGCTGATTC
solcap_snp_c1_11922 PGSC0003DMB000000085 1292330 TCCAATACGATGGGATTACGAGGAACTGGTTGGAA GGCAGGTGGAAATGT[T/C]TCAATTCGAGGAACA ACCTTCATGTTGGCTTCACCAACAGCTGATTCGTA
solcap_snp_c1_11922 PGSC0003DMB000000268 625280 TCCAATACGATGGGATTACGAGGAACTGGTTGGAA GGCAGGTGGAAATGT[T/C]TCAATTCGAGGAACA ACCTTCATGTTGGCTTCACCAACAGCTGATTCGTA
solcap_snp_c1_11935 PGSC0003DMB000000358 410905 ACTTGCACATCTGAACAGTCGGACTCCACTGGAAG TGCCGCTAGTGAACA[G/T]AATTCTTCTATCTTC TCAGATCCCCAAAGTCCTATTAGTGATGCAAATGA
solcap_snp_c1_11937 PGSC0003DMB000000358 299222 CGTGTGATTATTTGTGTTCCCACAAGGTGTGAAAC TGCAATTGAGGGTGA[G/A]TTGAAATTTGATGGG TGACCAAGGGTGTAGTTGCATGGGGAATGCGTGAA
solcap_snp_c1_11948 PGSC0003DMB000000358 357556 TACACCAACAGAGGTGGTGGCTCTGAGTCGGCAGG CTTAATCCAATTTGG[G/A]AAGAGATGACGCTTA TCACCTTCATACCATAGGTACTGATCCAGATATGC
solcap_snp_c1_11953 PGSC0003DMB000000033 2487876 AGCGGTGATTCATCTCATGTTTTGAGGATTTTTGA TGACGAAGCTCAAGC[A/G]ACGCAATCTGCTCGT AGCTCATCCAGAATGCTTGAAGAAACCTTGGCAAC
solcap_snp_c1_11955 PGSC0003DMB000000020 1863444 TTTGCTGCCCCAAGGTGCTCAGATATTCCAGAATT GATGGGAATTAAAGA[C/T]GTTTTTGAGAAGAAA TATGGAAAAGATTTTGTTTCAGCAGCGACTGACCT
solcap_snp_c1_11972 PGSC0003DMB000000020 1638547 GATGGGAGCGATGTAGCGGGTTCATTTGCACTTGC ATTTCCCTTGGTGGC[T/C]TCTGGCACCACACTG GCAGGCGAAGGCGCTTCAGTAGAATTGTGCTTGTT
solcap_snp_c1_11979 PGSC0003DMB000000111 1656011 GGGACATCAATTTGGAAGGCCATGTATAGAGAAGC TAAAGAGTGTGTTTA[T/C]GTCGAGCCAGATGAA GGTGACCAAAACAAGGGTGTCTTTTGGTATAAAAA
solcap_snp_c1_11985 PGSC0003DMB000000111 1438231 GAAGGTTTGTGTAGAGCTGCCATGTTTGCTTTGTT GGTGAAAGAAGAGCT[T/C]GAGTGCTGGCCTGAA CAGAGCCTTAGGAGAAGAAGTTGGTTGACAGTTCC
solcap_snp_c1_11991 PGSC0003DMB000000336 529071 AAACTGAGAACATGACTGACGATAGAAGAGTTCAC CCAGATTGTCGGAAT[G/A]CTTCGAACCCTTATC ATGAATGCAGCGAATATTGCTTCAAAATAATAGCG
solcap_snp_c1_11996 PGSC0003DMB000000069 192093 TGCTCAATGGGCTGATGTGTAGGTCCATCTTCTCC AAGCCCAATTGAATC[A/G]TGAGTCATAACATAG ATAACGCGTGATTCAGCCAAAGCTGAAATTCTAAT
solcap_snp_c1_11997 PGSC0003DMB000000069 192117 CCATCTTCTCCAAGCCCAATTGAATCATGAGTCAT AACATAGATAACGCG[T/C]GATTCAGCCAAAGCT GAAATTCTAATGGCTGCTCTCATGTAGTCAGTAAA
solcap_snp_c1_11998 PGSC0003DMB000000069 192195 GCTGCTCTCATGTAGTCAGTAAACACAAAGAAAGT AGCACAGTAGGGAAT[T/C]AAGCCGGGGCTGTGG AGAGCAATTCCATTACAGATAGCTCCCATACCATG
solcap_snp_c1_11999 PGSC0003DMB000000069 192267 ATTCCATTACAGATAGCTCCCATACCATGTTCACG AACACCAAATCTTAT[A/G]TTACGCTCCTCTGGG GTGCTCTTTTGGAAGTCACCAAACATTTTCATGAG
solcap_snp_c1_12003 PGSC0003DMB000000069 195115 GGTCTTAAATCCACCACTGCTACCTCATTCCGCCG CCATATTCTTCCCTC[C/T]GCCGCCGCCTCCGGC AGACACTCAGCGATTCGCGCTTCAGCTGCTGTAGA
solcap_snp_c1_12005 PGSC0003DMB000000069 195236 TTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCC TTTCTCGTTCAGTTT[C/T]TCGCCATGGCTCTTC TTCTTCCACTAACTCTCAGCTTTCCCCTTCTTCCC
solcap_snp_c1_12008 PGSC0003DMB000000069 377297 GCTTTTTTGTTGTGCCATTGTACAAGTCCTCCAGC GAAACCCTTAGAGTG[T/C]GCACTACATCTTCAC CTTTTTTCTTTCTGCTGCCTCTGAAGCTACCACCA
solcap_snp_c1_12014 PGSC0003DMB000000069 139030 ATTTGTTCTAGGTATTATAGAGCGCCTGAATTGAT CTTTGGGGCTACAGA[G/A]TACACAACTGCAATT GATATGTGGTCAGCTGGTTGCGTTTTCGCTGAGCT
solcap_snp_c1_12015 PGSC0003DMB000000069 191610 GCACTGGCACCGAATCTGTCAATTCCAATGGCCTT CCCCTTGGATCCGAC[A/G]ATCTTCGCCCACCCA AATGTGGTTCCAGCTTCAATGCTAACTCTAGCGGT
solcap_snp_c1_12016 PGSC0003DMB000000069 191617 CACCGAATCTGTCAATTCCAATGGCCTTCCCCTTG GATCCGACAATCTTC[G/T]CCCACCCAAATGTGG TTCCAGCTTCAATGCTAACTCTAGCGGTAACAGCT
solcap_snp_c1_12021 PGSC0003DMB000000325 12896 TTCACGTTCTTCCGGTCACAAACAAACCGGACAGC TTGAACAACTGTAGA[G/A]GCGTAATCCTGAAGG CCATATCCGACGGAAACATCAGAATCGGAAGATTT
solcap_snp_c1_12022 PGSC0003DMB000000325 13130 TGTTTCAACTGATCGGCATAAAGCATACAGGTATC GTACTCTCCGCGAAT[A/C]GCAGCAGCAGATAGA TTCCGGTAATCAGCACGAGCATCATCATTAAGTTT
solcap_snp_c1_12023 PGSC0003DMB000000325 13205 AAGTCACAGACGGCATCTACGGCAGCAAGCTGTTC AATGTCCAAATTACC[G/A]TCTTTGAACTGCTCC ACACATCTCTGTTTCAACTGATCGGCATAAAGCAT
solcap_snp_c1_12024 PGSC0003DMB000000325 13274 GAAGTGAAAACGGACAGATTCACGTGATATGTGCG AACAGGGTCAGAAGC[T/C]CCAATAGCTTTTGAC ACAAAGTCACAGACGGCATCTACGGCAGCAAGCTG
solcap_snp_c1_12025 PGSC0003DMB000000325 13301 TGGTCAATTGCCCAGAAATCAGGAATTGAAGTGAA AACGGACAGATTCAC[G/A]TGATATGTGCGAACA GGGTCAGAAGCTCCAATAGCTTTTGACACAAAGTC
solcap_snp_c1_12026 PGSC0003DMB000000325 13346 GAAGGACGTTCATCTAGTTTGTGGATGGGAACAAT CGGGAATAGTTGGTC[A/G]ATTGCCCAGAAATCA GGAATTGAAGTGAAAACGGACAGATTCACGTGATA
solcap_snp_c1_12027 PGSC0003DMB000000325 13361 AGAATTCCCCGAGCTGAAGGACGTTCATCTAGTTT GTGGATGGGAACAAT[C/T]GGGAATAGTTGGTCA ATTGCCCAGAAATCAGGAATTGAAGTGAAAACGGA
solcap_snp_c1_12028 PGSC0003DMB000000325 13385 TCACTGTCACATGTCAAGTCGGATAGAATTCCCCG AGCTGAAGGACGTTC[A/G]TCTAGTTTGTGGATG GGAACAATCGGGAATAGTTGGTCAATTGCCCAGAA
solcap_snp_c1_12030 PGSC0003DMB000000325 192912 CCACCAAAGAAACCAGATTTCGGTGATGCAAACGT GACAGTAATTCTATC[T/G]CAGTATAGAACTCTT TTTCCCCCTGTAATGAGCCTTGCTGTGCACGTTTT
solcap_snp_c1_12031 PGSC0003DMB000000325 28487 TATCCTCTTGCAATTTGTTTATCGAACTACATTAC AAAGAATGTTTCCGG[C/T]TATCTCATAAGTAAA TGAAATCCCCTTGTAGTTGAAGCAGTAAGTGTTAA
solcap_snp_c1_12032 NM NM AGGGATTCGAGGATTAGTTGAAGAAAGCTCTTCGT TTCTGACATTTCAGG[C/T]AGACACAACCAAACT CTCTTTTCAAAGTGTTTCTCGATCTGTTCATCGTT
solcap_snp_c1_12039 NM NM CGTGAAACAAAAGAATGAGCTACATTTTCCAAACT GTCATTCAAAACTTC[G/A]GTGATAGCAGATGTT ATTGCTTCTGCCTGTTCTGATGGTACACCTCGTGC
solcap_snp_c1_12051 PGSC0003DMB000000346 430793 CTGTAGCCTTCTGGATTAAATGCTCCAAACTTAAA GGCCTTTGTTGTGTA[G/A]CCAATGATCACACAT GGTCCTTTGAAATCAGATCTGTTATGGAATTCAGT
solcap_snp_c1_12057 PGSC0003DMB000000541 41835 TTGAAAACAGAAGTTCCATCTGATTCTGTTCCTCC AGGACTAAGTTCAAG[A/G]TATGAAGGAAACTTA ACTTCTTTCAAAGTTGATGAACATGTAGCCCTTTC
solcap_snp_c1_12063 PGSC0003DMB000000541 78874 TATGATTATGATGACTCCGAATCTATCTGTTCGCA TACAGAATTTGACAT[T/C]GATGAGTGTGTTGAA GTGTCTGAGGACACTACACTTATCTCTCTAGATGT
solcap_snp_c1_12064 PGSC0003DMB000000541 79735 GAAAGGGCTACATGTTCATCAACTTTGAAAGAAGT TAAGTTTCCTTCATA[T/C]CTTGAACTTAGTCCT GGAGGAACAGAATCAGATGGAACTTCTGTTTTCAA
solcap_snp_c1_12078 PGSC0003DMB000000479 129858 AATGAGTTTGGCGGAAGGAAAACTTATATGCTTAG AGCTATCGATGATCC[G/T]AATTATGCCGTTGGT TTTGTTGATCGGAAGGAAATGGAGTGTTTGGAATT
solcap_snp_c1_12080 PGSC0003DMB000000029 2450977 TCGACAAAGCAGCTAACTGAGGAAGCAAAATAAGA ATTGTTGTCAATACA[T/G]GCAATCTGGCACCTT CCAGATCCTTAACTGCTTCCATTACATCCTTGGCA
solcap_snp_c1_12082 PGSC0003DMB000000135 1484071 GATGTAACTTCTTCTCTACTAGCAAAGTAATTTTC CTTATTTGTAAGAAA[A/C]CTGTTTACTTGAAAA AAAATGTTCAACAAAACTTTTTCCAAAAACTAGAG
solcap_snp_c1_12106 PGSC0003DMB000000104 701964 ATATACATCCAGCCATAATCATCCTGGTCCAAATT TGCCTAAAGACTCTG[T/C]TACACAAGAGCAAAT AGTGGATCAACATGTGTCCCTCGAAGACAACAACG
solcap_snp_c1_12108 PGSC0003DMB000000104 701729 GATGATTTTCTGCCTCTTTCTTACCCTCAACTAAT GAAATTTCCAAAATC[C/T]GAGTTGTCGGAAGAG AATGACTTTTATGATGAATTAGGAGAATTGGAGCT
solcap_snp_c1_12114 PGSC0003DMB000000104 653286 CCAGCGTGAAGAGCATCAGCAGCCAATTGTAACCC TACATCCTTCTTCGC[T/C]CTCAGAAAACTCTCC ATCGGATCATCATCTACATCATCCTTATACTTATC
solcap_snp_c1_12118 PGSC0003DMB000000104 892053 TACGAAGGTGAAGTAGAACCCCATCCTCAGAGTCC CTGGGAACTACATGA[T/C]GTAGATAGTTCATGG GAGCAACCTCAACTTGACTTGGAAAGCAAAAATAG
solcap_snp_c1_12131 PGSC0003DMB000000104 568859 GTCAACTCTGGATTTTTGTAGTATCCAGCAAAAGT GGTCCTCCCTCTCAC[G/A]CATATCTCTCCCCGG GGAGGGTCTGCTAGGGGATCATATCCCATTTCAGG
solcap_snp_c1_12139 PGSC0003DMB000000553 14692 CATCTCAACCCGGTTATCTCCTTCTCAGCTGCGCT AGTCGGAATTATATC[T/C]ATGTCAAGAGCCATA ATTTACATTGTGGCTCAATGTCTTGGTGCTGTTTT
solcap_snp_c1_12152 PGSC0003DMB000000536 115121 AACATCCTACCAGGTACAGTTGTAGATACAGTGAT CACTCATCCAAGTGA[G/A]TTCGACTTCTATCTA TGCAGCCATTGGGGTGTAAAAGGAACAAGCAGGCC
solcap_snp_c1_12159 PGSC0003DMB000000009 1490628 ATCATGTAATCACTGATTTTGCTCCCAAAGAACTC CCTCAGACTCTGGAC[T/A]GCTGCGTGTTCTTCT CTTGAAAAGCGACTTCGCACAGATAAAACTACAAG
solcap_snp_c1_12160 PGSC0003DMB000000009 1490637 AAAACCAAAATCATGTAATCACTGATTTTGCTCCC AAAGAACTCCCTCAG[A/G]CTCTGGACTGCTGCG TGTTCTTCTCTTGAAAAGCGACTTCGCACAGATAA
solcap_snp_c1_12161 PGSC0003DMB000000342 286847 AACAAGCTCTGCTATGGTGGATCAATGGATTGGAA CATGATCAATGTTGG[C/T]GCTCTTTTATTGTTC AAAGGACATTGGGTTGACAACATGTCAATCTTGAG
solcap_snp_c1_12162 PGSC0003DMB000000342 286901 AAATCGTACAATTTATTCACTTGCAACAGCTATTC TTTTCTTGCTAATTG[T/C]TTGAACAAGCTCTGC TATGGTGGATCAATGGATTGGAACATGATCAATGT
solcap_snp_c1_12166 PGSC0003DMB000000597 12249 AACGAAAAGAAAAATCATGGAAAAATCAATGTGTA TTAGGGATGGCATGT[G/A]TTGTAATTATTGGAT TAGAATTTGACAGCTCAATTTTAGGTAATCAAGAA
solcap_snp_c1_12169 PGSC0003DMB000000265 505997 GTGTCACATCCGTTCCACGCTCTTTTCTATATAGT GTTCATGTTATCAGC[C/T]TGTGCCCTGTTCTCA AAGACCTGGATTGAAGTTTCTGGATCATCTGCCAG
solcap_snp_c1_12178 PGSC0003DMB000000334 557647 GCTGAATATTTTGAGAAAGATAACCATGGGAGAAA TGGTTGGGCTCGACT[T/G]CAGCCCTTGACTCTA GGCAAGGATGATGAGAACAATCCTGACCTTTGCAA
solcap_snp_c1_12179 PGSC0003DMB000000334 520911 CGTGCTTTCGGTGCTGAGTTGGTGCTTACCGATCC AGCAAAAGGGATGAA[G/A]GGTGCTATTTCAAAG GCTGAAGAGATAAAGGCCAAAACACCCAACTCCTA
solcap_snp_c1_12180 PGSC0003DMB000000711 65843 GCACGGGCTTTACGGTCTCGCACTTTTACAACCAT CTCCAGCACCGTCAC[A/G]GTACCCTCACTCAAG AAGGCTTCTCAAATGGAGACGCGCCTCCTCCTTGG
solcap_snp_c1_12182 PGSC0003DMB000000711 52036 AATCTCACTCTGAAGTTGCACTTGCATCTTGATAT CATAAAATATCTGCT[A/G]GCCTTGCTGAAATTA CTTGACGTGTATGTTTAACCGTGTAAGCAGTAATT
solcap_snp_c1_12187 PGSC0003DMB000000334 691288 NNNNNAAGTATAAGGAAGTTCTAAGCAAAATATGC ACACAGGCATGGGCA[T/C]AACAGTGAAGTCCTA AGGGAGTAAAAAATGGGTCCAACAAGGGCAACTTA
solcap_snp_c1_12189 NM NM GAAATAGCAACTAATGTACTAGGAGTTTGTGATAA AAATCTTAATTTTAC[T/A]TATGTATTACCTGGT TGGGAAGGATCAGCGGCTGATGGTCGTGTATTACG
solcap_snp_c1_12190 NM NM AAGGGAGAAATAGCAACTAATGTACTAGGAGTTTG TGATAAAAATCTTAA[T/C]TTTACTTATGTATTA CCTGGTTGGGAAGGATCAGCGGCTGATGGTCGTGT
solcap_snp_c1_12208 PGSC0003DMB000000047 903366 TCCTCGTTACCATGAAACTAAACACTCCGTGCACC AAATGTAAGCTTCTT[T/C]GAACTTTAAAGCTGA AACTGCAGCACGTCCTGCTCGAGTTGCCATCCTAT
solcap_snp_c1_12220 PGSC0003DMB000000379 498403 TTCTGGTCAATCGGTTTCTACTAGTAGCAGTATTG GGTCTCCATCGAGCA[G/T]AAGTGAAGCGGCCAT GGCTACCCCTGCCAGTGACAACACTTTTCTTAGGC
solcap_snp_c1_12229 PGSC0003DMB000000379 523717 CCAGACTCTGTCCGCGCCCAGAAAGGTCTGCTTCC ACAAAGAAGAATATA[T/G]GCAATTACACCAATA CTCCACATGTCAGCTTCTGTTCCATAAGATCTATG
solcap_snp_c1_12234 PGSC0003DMB000000506 352820 TTGCTAGCAAGGTCACGAACAGAAAGGCGGTTGTG TTGTTCTGTCAGCCG[G/A]TCTGTTTCTTCCTCG ACTACCTCCTTTAAAGGTGGGCCTTTATTATCCTC
solcap_snp_c1_12236 PGSC0003DMB000000506 311041 CTGCTCTTTGGTGGGTTGGTTCCTTTACTGAATGT GAGATATGGAGGTAC[A/G]AGGGAACCATTTATG GGTGGATTTTCTATTGGGAGTGGATTTTATGAGAA
solcap_snp_c1_12251 PGSC0003DMB000000083 725290 TGCATTCGCTTTCTTATAAAATTGTTAAGACCAGT TGCTGCTCCTGCTTC[C/T]GTAGCAAAGGCTCCA ACTATTGGGAGCAAACTTTTGGCGATGCGCTTAGA
solcap_snp_c1_12256 PGSC0003DMB000000083 701736 GCGTCCTTGGCAGGAGCAGGAGGGGGTGGTATCAT GTGAGGTGGTGGGGT[G/A]TGCTTAAGCTTCAGC AGTATGTGGCGCATCCTTGAAAGATCGGTAGGTTT
solcap_snp_c1_12257 PGSC0003DMB000000083 699922 TCTGTTTGCATTTGCTTGTGTGCAAAAGAGAGCTG TCTTTATGTACCTGA[T/C]GACTTCTTTTTCCGG GAAATCATCTAGTTCTTCATCCACCAACTCCAATA
solcap_snp_c1_12264 PGSC0003DMB000000083 660179 CCTCTTTGCAATCATCAAACAAGGCTGTTTCCCCT GAAGAGACTATGAAG[G/A]ATTTCTTAGCTTCAA ATTCCAACAATGGGTTTTCCATTGGATTCATGGAC
solcap_snp_c1_12287 PGSC0003DMB000000083 566748 AAAGCAAATTTGCCTTCAAGTTCTTTGATGACTTG ATCAGGAGGGTATGG[T/C]GCCCGATCCCTTAAA ACTTTGTAAGCCTCAACCATTATCATAGCTTCTGT
solcap_snp_c1_12296 PGSC0003DMB000000235 28546 GAGCTGACAACTTATAGCCGTAGCACATTCCATGA GCATTCATTTGCTGC[G/T]AAAACAAAAAGATGG TTGGAGGCATATCCATATAGGAAGAACGCACTTCT
solcap_snp_c1_12305 PGSC0003DMB000000527 161804 TCTTTTAGCACTAAGTCTAACAGCTTATCCCTTCC TCTTCTTAGACACTC[T/C]GCCCATAGCTCCTCA AGTAGTGTCTCAGCTTGTTTCTCAACTACATATCT
solcap_snp_c1_12310 PGSC0003DMB000000527 67589 GAGATACCTGCATCTGTGGTATACGAGGATCAAAA GGTTCTTGCTTTTCG[C/T]GATATCAATCCTCAA GCTCCTGTTCATGTTCTAATTATCCCGAAGTCGAG
solcap_snp_c1_12320 PGSC0003DMB000000527 245680 AACTTTTTTCTCTGCCTGGAATGGACCCAATGTAC TAGGAGCTGAGGTCT[G/T]ATCTGTTTCCTGCTT TTCATGTGAATCTTGGGTGTCTGAAGAAGCAACCT
solcap_snp_c1_12329 PGSC0003DMB000000527 2176 AAGGAGAAACTAGCTAATCAGAAAGCTCTACGTCC TCCTTTGGTTGTAAA[C/A]CATCACGCAGCCCCT GCAGCTGATTCAGTTCAGTAACTGTCGAAACTCTT
solcap_snp_c1_12330 PGSC0003DMB000000527 2156 GAAAGCTCTACGTCCTCCTTTGGTTGTAAACCATC ACGCAGCCCCTGCAG[C/T]TGATTCAGTTCAGTA ACTGTCGAAACTCTTTCATGGTCAGATTTGTAATT
solcap_snp_c1_12339 PGSC0003DMB000000527 209615 CTTTCCAGAAGAAAGTTGAACTTGCTAAAGATCAA TCTCTGGAAAAGGAA[A/G]TGCTTAAGGAGGCAA AGATGAAAAGAGAAAACTCTGCACAGAAATTGAAT
solcap_snp_c1_12345 PGSC0003DMB000000527 208632 ACTGATGAATCACCCATTATTTTAGCTTTGGAAAA AATATCAGAGAGGAA[C/T]TCTCGGGGATAGTGG TCATTAATGTCAATAAGAATGTCACCATGCTCAGG
solcap_snp_c1_12354 PGSC0003DMB000000527 200906 TGGCCGAGGAACTTCTTTGATGTATGTACTACCTT GACTCTTGGGAAACA[G/A]CCATGTGCCAGAGCT TGCTTGATTATTGAAAACGTAGCGGTGATTGTTGC
solcap_snp_c1_12373 PGSC0003DMB000000415 191878 CTTGCTGAGTATATAAGGTATGGTATTCTTAATCT TGATAAACCTGCTAA[T/C]CCATCTTCACATGAA GTTGTAGCTTGGATTAAGAGGATCCTTCGGGTCGA
solcap_snp_c1_12375 PGSC0003DMB000000415 191428 CTTGGGTTGCTTTTGGGTGTGGGTGGACATATGCA GGAGCTTAGGAGAGT[A/G]AGGTCTGGGATTTTA GGTGAGAAGAATAATATGGTGACAATGCATGATGT
solcap_snp_c1_12377 PGSC0003DMB000000415 380564 TGAGATGATTTCTTTGGATCAGTCGTTGAAGAAAC CCTCAAATATTCTGT[T/C]TAAAGTACGTGTAAG AGACTGCTCAAAGTATGGCACATTCCTCAACAAGA
solcap_snp_c1_12381 PGSC0003DMB000000415 99985 GTTCCACTCACAACTGTTTGATGCTATGAAAAAGG AGGGAATTGAGATTG[C/T]GGAGGAGCATCGTCC TGATACATGGATTCCTTATTGCCCAGTAGCTGACG
solcap_snp_c1_12382 PGSC0003DMB000000415 67841 TGGATGAGACAGCATCAATAGCAGAGCCTAATGGC CATGCAGCTTCAACA[A/C]GGTGATTTTTGTAAT TAACTTGATGCACCACTGTAATCTTTCTGATTGGA
solcap_snp_c1_12386 PGSC0003DMB000000415 310532 TGATGCTGAACCAAAATCTTCTCATCATCGAACTC CCTGTCACAGTAGTA[G/A]CACCATACCTTATCG GTTGATCTCTTCTTCTTCTTCCCCATTGATCCCTA
solcap_snp_c1_12406 PGSC0003DMB000000344 322014 ATATACTTCAAGAAGAAAAAGACGGGAGGGATTTC TTTCAACAGCACGTT[G/A]CATCTGACACATATT GATGAGAAGCTCTGCTATCAAATTCTTCATGAATA
solcap_snp_c1_12409 PGSC0003DMB000000019 349755 CTACTATGGGAAACAGCACTCCATATCCAGGAGTT CATTGATAAAATAGC[G/A]TAGATATGCCACAAG CCAGTGTATTCATAATATGGCTTCTTCTTCGGGCT
solcap_snp_c1_12414 PGSC0003DMB000000649 97717 GCGGCGATCACTATTCACAAGGATCTTATATTCTC CTTTAGAGTTTGTAA[A/C]ACCTTCAACTGTGTA TGCCAAATCGTTAGTGTCCCTATTCTTGCACTCGA
solcap_snp_c1_12419 PGSC0003DMB000000543 255276 CATTTCTCCTCGGCGATTTCCGGCGACGATCCGAT TTTCCGGCGATATCC[G/T]GCCGTAGAGAACAGA GACATCCTGGTTCCCTTCGCCTTTGGATCAGTCGA
solcap_snp_c1_12420 PGSC0003DMB000000543 258453 CTGCAACTTAGACATGGAAACGCAACGAAGTGAAA ATATCAAAGGAGGGA[G/T]AAAGAGTCCTATACT TGAAAAGCAATTCTTGTGGGTTGTATAGGCCAGTT
solcap_snp_c1_12424 PGSC0003DMB000000649 219202 CCAAGAAGTACATATTTCATTTGGTGTTAGAATTT TGAACTTTCGATTGA[C/A]ATTCTTCTTTAGATG TAATGACTATCGGGTGAATTTTCTTCGCCCCATTG
solcap_snp_c1_12439 PGSC0003DMB000000543 271488 GCTTCAGTCGTCTAATCCCCTGTTTAACTGAAACA TGGGGAGATTTACCA[C/T]TAAAAGTCGACGATT CCGAAGATATGGTAATTTACGGTCTATTAAAGGAC
solcap_snp_c1_12440 PGSC0003DMB000000543 286228 AATGAGGTTTGAGAATAAAGGGTACTACTTGTTTC TGATGATGAAGAAGA[G/A]GAACAATAATTTTCC ATGAAAACAACATCATCAAGAAGATGTTGCCTTAT
solcap_snp_c1_12441 PGSC0003DMB000000543 286361 TGTTGAGTTATCGAACAAACGAGAGGCAGATTCAA GATTTAAACTTTGAG[C/T]TGTATTGATGAAATC AGGATAAAAAGAGAAATTGCTTTCAAGTTTGATCT
solcap_snp_c1_12442 PGSC0003DMB000000543 286371 GGAATTCAATTGTTGAGTTATCGAACAAACGAGAG GCAGATTCAAGATTT[A/G]AACTTTGAGCTGTAT TGATGAAATCAGGATAAAAAGAGAAATTGCTTTCA
solcap_snp_c1_12443 PGSC0003DMB000000543 286486 TACTCTGTTTTTACTTCCCCTGTTTTTGGTTCCTC TGTTTTCTTGACAGA[A/C]GGAATTGAAATGTTT AACGAAGGTTTTCGATCATTGAAACTTCTTTTCTT
solcap_snp_c1_12444 PGSC0003DMB000000543 286572 TCTCCGCTGCAAATTTCCCCCATGGCCTTTGTCTC ACTCCTCTGTATCGC[T/C]TTTTCTCCGAATTTT CCACCATTTTCTGAACAGAGTACTCTGTTTTTACT
solcap_snp_c1_12445 PGSC0003DMB000000543 286952 AAATGGTAGCAACTCCATTAACACCTTCAAATTGG TCTTCAATTTGGGAT[A/G]GTGGAAATGGAAAAG GTATTTTTGAAGTGCCACCTTTGTCACCATTATCA
solcap_snp_c1_12446 PGSC0003DMB000000543 287013 AAAAGGTATTTTTGAAGTGCCACCTTTGTCACCAT TATCACCACATCCAA[G/A]TTTTGGTTACTCTCA ACTTTTGGTTTCATAGTGAAATGACCAAAAAAATC
solcap_snp_c1_12447 PGSC0003DMB000000543 287023 TTTGAAGTGCCACCTTTGTCACCATTATCACCACA TCCAAGTTTTGGTTA[C/T]TCTCAACTTTTGGTT TCATAGTGAAATGACCAAAAAAATCCACTTGAATA
solcap_snp_c1_12448 PGSC0003DMB000000543 287260 TGAGGTGATTTCAAGTTGTAAAAAGGAATTTACCT TTTGGAAATTTGGAT[A/G]AAAGTATTTGAAGAT TAGCATATGTACAAATGAAGAAACATGGAGTGATG
solcap_snp_c1_12449 PGSC0003DMB000000543 287305 TGGATAAAAGTATTTGAAGATTAGCATATGTACAA ATGAAGAAACATGGA[G/A]TGATGGAGGGAGAAT GGAAGTGTTTTGAATCATGGATATTTTTTATTATT
solcap_snp_c1_12454 PGSC0003DMB000000512 273638 CACTTGCAGCAAGGGAGATCACTTATGGCCCCTTA CTTGCCGCAGGGTGG[G/A]GCCGGTGGAGGTGGT AGTCCATATTCGGAAGGTGGTGCATTGTATGCTCT
solcap_snp_c1_12455 PGSC0003DMB000000512 273611 GCCCCTTACTTGCCGCAGGGTGGGGCCGGTGGAGG TGGTAGTCCATATTC[G/A]GAAGGTGGTGCATTG TATGCTCTTGGGTTAATTCATGCAAATCATGGGGA
solcap_snp_c1_12456 PGSC0003DMB000000512 230480 GTCACTTCAAGATGCCGCCATAGCTCTTCATCATG TTCTTTCAAAAGTTG[A/G]GATAGCCTTGTAATT GTGGAACGAATACCAACAACACTATTATCAAGTTG
solcap_snp_c1_12508 PGSC0003DMB000000004 1021887 GAATAGCGATGAAAGGATCCAAAGCAGGTCTCAAC TGCCCCATTGACCTT[C/T]CCATCCAAATCAATT GTCCACAATGCAGTCAAATCTTTCTGAACCACAAC
solcap_snp_c1_12509 PGSC0003DMB000000004 1021060 CCCTTACAAAAGAATCACTTCACTGTCTACAAAAG CTGATCGCTTGATTT[T/C]GAATTTTTAAAATTA CAATAACTAACAAGACAAGAAATTTGAGAGATACT
solcap_snp_c1_12564 PGSC0003DMB000000002 911613 GGTGCTCACTTTACTCCTTGGGCTTCTGTTTTGGG TGATTCTTATCGTGG[G/A]CTTGAGAAATTGTAC CTCAAACGTATGTCCATATCTGATGATGATCTAGG
solcap_snp_c1_12584 PGSC0003DMB000000382 264029 GTTCTTATTGGTGGCAACAATGGTTTGCTAAACGA CGTATTAAGAAGGAA[A/G]TTGGTGTCGGTGGGG GTAATTTGGTCATTTCATCTTCATCATCAGATTGT
solcap_snp_c1_12588 PGSC0003DMB000000382 58244 TTTACATGCAGCACCCTCAGGCTGCAGCCATGACT CAACAACAAGGTATG[T/C]TTACTTCAAAGATGC CACTGCAGTTCAACAACCCACAGCAACTACACGAT
solcap_snp_c1_12597 PGSC0003DMB000000096 1160519 AGACCCTTTTCTTGGGTTTCTCCATCTCTTCAAAG CCCTCCATTGTTGTT[G/T]CTAAGACCCATCGAG CTACTCAAATTTGTTGTCAAGAAAAGACAGCACTT
solcap_snp_c1_12619 PGSC0003DMB000000008 3737374 AGCAGGCTCATCCAATGATATGGAATCAAGTGTTA GAGGATCTAATTTAC[T/C]TGATTTTGGTGAAGG TGAAACTGAAAAAGGTGATCATGAAGTTGTACTAA
solcap_snp_c1_12644 PGSC0003DMB000000008 3706878 TGCACATGACATTCAGCCCTTGTTTCCAGAATATT ACAACAACTACGCCT[C/T]GATCCCAAGCTAGTT GATGCCAGCTATATGGATCCTCCCTCTCCGAAGCC
solcap_snp_c1_12685 PGSC0003DMB000000298 255460 ACCATTGTGTTAAACTCTGTTGCTATGACCAAGAG GCGTCATCTGATTAT[A/G]CTGAGAGTAGTTTTT GTTTCTGTTTCTATTTGTAGTGATAATGCTTACTT
solcap_snp_c1_12691 PGSC0003DMB000000315 683885 AGAAGTAGGAGGGACGGAAGAGTTGGAAAAGGAAG TGAATCGAAGGACGA[A/G]ACTTTCAAAAGGATC ATGAATGATTGATCTCATTGTTCATAAACACAGGA
solcap_snp_c1_12702 PGSC0003DMB000000078 295354 AGGTGCTAGAACGGGGTGAAGATGACCTTCAACAG GAGGGCCAAGAAGAA[C/A]GGGGTGAAGATGACC TTCAACAAGAGGGCCAAGAAGAGGCTGTTGTGGTG
solcap_snp_c1_12728 PGSC0003DMB000000020 3034677 ATTCTTTCGGAGAACCCGGGTATGGTATTTGATCA CCATAGCCCGGTTTC[A/G]GTGCTGGAGAATAGT AGCAGCACCAGCCACAGCAGTGGCAATGGTGTTGT
solcap_snp_c1_12745 PGSC0003DMB000000712 20262 GCTGACAAATGGGGCACAGAAACAGCGAAAATCAC GCACGCTAATCCTGC[G/A]ATTATGATGAAGTAT GGAAGCTTCATCTCATGATCCTCCCTAAAGAGAAG
solcap_snp_c1_12749 PGSC0003DMB000000411 414432 ATGGCTCCAAGGCACTGCATCACCATGTAGAATAC TGCCCTTGTCAATGA[T/C]AATTTCCTCGCTAAG AAAAGCCCAAATGTCACTGCCGGATTTATATGGCC
solcap_snp_c1_12751 PGSC0003DMB000000411 413587 AGAATGTATGTAATTTGCGGCATATGTTTTAAATG GACTTTTGCTTTTCA[T/C]TCAAGTCCATAACAG AACATGCATGCTCATGGGCCCAATAAAAACTACCT
solcap_snp_c1_12771 PGSC0003DMB000000004 684289 AAGCCCCAACAACTCTGCTGAAGAGGCAAAGTCTT TAATCCCGCAGGGCG[C/T]TTCAAGGGGAGAGAA GCGAGTCTCCAATAAACGCATTAAAACGGAACTAG
solcap_snp_c1_12786 PGSC0003DMB000000110 235206 GATAAGGCCTCACCGTCATCCCTCCTTCTCTTCCA CCGCCGTGGTCCGCC[G/T]TCACCTTCGTCGGAA AATCCGCAGCATTCGTGCACGCGAAATTCATTATT
solcap_snp_c1_12797 PGSC0003DMB000000110 133926 ATGTCATGATCACAAAGAATAAATATCCGTTTCAG TGCTCTAACACAACG[A/G]GGTTTAAGAGCCTGA GTTTCATGATCAAAGAGTGGAGCTGTTGGATGAAG
solcap_snp_c1_12798 PGSC0003DMB000000110 133667 CTCACGGAACTGTTGCATGATTGGAGCCATCACTT GCTCAAGATTCATAT[G/T]ATGCTCCTCATCTCG CTTATCTAGCTTACAGCCAACAACAATTACCGGCA
solcap_snp_c1_12802 PGSC0003DMB000000110 337929 CGGCGCTGTTCCGGCTTTGGTGCAGCATCTACAGG CGCCGCCTCATGTAA[A/G]TGAAGGTGAAGGTAG TCACATGCCATACGAACATGAGGTTGAGAAAGGAA
solcap_snp_c1_12821 PGSC0003DMB000000214 859369 AATTGTTGAGTGTATTGTTGGATAAGAACATTGGC ATATTGTTGAGGAGT[A/G]AATTGTCTACTTGTT GAATAATATTGGGGCATAAAATAATTGTTGAGATA
solcap_snp_c1_12825 PGSC0003DMB000000214 872029 ATTGAAGGCTATCCCCCTTTCCATGCGAAGGAAGA AAACGATGTACCTAA[G/A]TTGTATGCTGCTAAA GAGCGCCCTCCTTTTAAAGCCCCGGCAAAGTTTTA
solcap_snp_c1_12835 PGSC0003DMB000000042 699172 TTGCCTCAAAGCTGCAGCAGTTTCAGCAAATTCAG AAGCAACATCATTTG[C/A]ATTCAAAGTCACAGA CTCAATCACGTTTTGTTTCTACTTCATCTGCGAAG
solcap_snp_c1_12858 PGSC0003DMB000000171 911220 CGGTCCCCAGAGAGCACAATGGACATCATGCCATG GCATACGTGGATACT[G/T]TTTCCGATCTAATTC ATCCTTCATGGTATCTTCCCAGGAATTTGGTTCAG
solcap_snp_c1_12877 PGSC0003DMB000000404 267974 GAGAAAAAAAATCTAAACATGGCGGTGGCACCGAC GGCGCGTGAGGAGAA[C/T]GTATACATGGCAAAG CTGGCGGAGCAGGCCGAGAGGTATGAAGAGATGGT
solcap_snp_c1_12887 PGSC0003DMB000000013 3218678 GCTGGAAGTGCTGGATTTATAAGGACCGTGCAAGC ATTGGACACCATTGG[G/A]AGCAGCTTGAATAAT TTGAATTTAAGCAGTGGATTTGTTTCTGGTGCAGC
solcap_snp_c1_12895 PGSC0003DMB000000063 543145 ACCTGCTATTCTGCTTTAAAGGAGCGAAAGACGAA ACCTTTAAATTACTT[A/G]TGGACCTAAGCCCCT CAAAGGATGCAAAACCCTTGGCAGAAATGGATGAC
solcap_snp_c1_12896 PGSC0003DMB000000623 84618 ATCTTAAGGGAGTTCAAGAAAGGAAGCTCCGAACG GCTACCTCTCCAGCT[T/C]GGATCCACACCAAAA GGATAAGGATCACTGTATTTTATTAACCCCACTGT
solcap_snp_c1_12899 PGSC0003DMB000000623 154762 CAGCAACAACAGCCAGTTAAAAAAAGTAGGAGGGG ACCTAGGTCCAGAAG[C/T]TCACAGTACAGAGGT GTTACTTTTTATAGAAGAACTGGTAGATGGGAATC
solcap_snp_c1_12912 PGSC0003DMB000000003 4030880 CTTCTTCCATTTCCAGCTGGAATCAATGCTTTATT TAGTCACGGACCTGC[G/A]CGATCAGCAGTGCCT GCCCGTGTCTATGCTCTATGGAATATCATCTCAAC
solcap_snp_c1_12922 PGSC0003DMB000000208 993121 GATTACTTTTCTGGGTGAAGGTCACCATAAGTACA GACATTTGAACCACA[C/A]GCTCCCATATCTCAT CATCGGAAGCAATATTTTGGCAGCAAGCATCAAGA
solcap_snp_c1_12926 PGSC0003DMB000000467 138404 TGTCCGAGACGATGAGCTGATTCTGGAAGCATTCA AGAAAATGAGAGATA[A/G]TAATATCGGAGGTCT GCCAGTTGTTGAAGGACCAAAGAAGAAAATAGTTG
solcap_snp_c1_12938 PGSC0003DMB000000467 291661 GGGCGTCGTGCTCTCGATAAAATGAAGGTTGGCGT AGAGCAGAATCTTGT[G/A]GATTGGGCAAAGCCA TATCTAGGGGACAAGAGGAGGTTGTTCCGAATCAT
solcap_snp_c1_12945 PGSC0003DMB000000213 787401 TAGTAGTTCTGGGTGTCAGAGTCTTGAAGTTGTTT GAGAACAGGTACATA[T/C]GAAGCATTTAACCAA CTAAACTCTTCGATCTTTTGTACGACAACAGTCAC
solcap_snp_c1_12966 PGSC0003DMB000000145 640009 AAGATTCACTGGCAATGCCAGTAGAGCCCGTATGT GGAGTAGAATAGGAG[C/T]TTGGACTGGGAGAGA AAGCAGAAGAAATTGGAGAAGATTCTGACATGAAG
solcap_snp_c1_12976 PGSC0003DMB000000413 459523 ATGATTGGAGATCCAATCGCTTTGCCTTTCGCGAC TACAGTTGACAATTG[A/G]AAGACTAGAAGTAGA CTACTAACAATAAGAACCCTGGAGTAGCCCATTTT
solcap_snp_c1_12978 PGSC0003DMB000000413 459376 CCTTCTTCTGTGTTGTTAGCTTGGGCTTGGAAAGT CTCGATGACTTTTGT[T/C]GATACAAGGTAGTTA AGGAATGTATGGAAAGGCCCTGCAACGGAGAGTAA
solcap_snp_c1_12981 PGSC0003DMB000000008 3969311 TCAGGTTCCCGGGTCAATTGAACTCTGATCTTAGG AAGCTTGCTGTTAAC[C/T]TGATCCCCTTCCCTC GTTTGCACTTCTTCATGGTTGGATTTGCTCCTCTC
solcap_snp_c1_13006 PGSC0003DMB000000599 135943 GAAAAGTTGATGGATAAAGTTTGAGTCTTTCTGGA TTCTTGAAGGGATCT[T/C]TTTGAGGAAGAAGAG AGGATATGAGTAGCAAAATTGTTGAGTGCTGACAT
solcap_snp_c1_13017 PGSC0003DMB000000599 57471 AGGAACAACGGTGAAGTTTTGTTTTCAACTAGGAA CAATGATCTGGTTTC[G/A]TATGATCCAAATAGT GGACGAAATAGGGGTCTTCGTATTCAAGGGAGCTC
solcap_snp_c1_13025 PGSC0003DMB000000599 208638 AACAGTAGTTAAAAACATTTATATATTATTCTCTG GAAGTGAATTGCCAG[C/T]AGCAAAGGATGATGA AGAAATTATGGACTTGGTTGATCCTTCTACACCAT
solcap_snp_c1_13043 PGSC0003DMB000000723 131240 AATGACCTTGCTGGGTTCATTGAAGCTCCTGAAAA AGGTCCTCCAGCCAT[T/G]ATATTGGCCCCAACA ACAAGCCCAGTTAGAAGTGGGCCCATTCCTTCAAG
solcap_snp_c1_13052 PGSC0003DMB000000711 116125 CGCTGAACTCAGGCTTGTCTCGCTTGATCTCTATG AATGTCCCGTGACGA[G/T]GGTTAAGGATTATCG ATCTAGGGTTTTTGGTTTGATTAGGTCGTTGAAGT
solcap_snp_c1_13059 PGSC0003DMB000000039 2551828 AACTTCTCAGAGAGAATACACATCAATTCATAACA TCATGCAGCAACCCG[G/A]GACGAAATGAAAAAT ATCATGAGTTACAATCTGAGCACGAAATCATTCAC
solcap_snp_c1_13066 PGSC0003DMB000000228 282582 CAGTCAAGTGGGGAGATTACATCAAAAAAATTGGT ATTGACGGCACTGCA[G/T]ATGCGATCAAGGAAG CTATTAAATCTGCTTTTCGGTTAAGGACTAAGCGT
solcap_snp_c1_13068 PGSC0003DMB000000069 611803 TCCAACGCATCATTGATTCGTTTCCGATCCAACGG TCCACCGATCATCTC[T/C]GACTTCGATGAACCA CCACCACCTCCTCCGCCACCTCCTCGATCTCTATA
solcap_snp_c1_13077 PGSC0003DMB000000184 1145841 CCTCCACCACCCCTTGGTGATCTTTGACCTGACGG TGTTAGAATCTCAGG[T/G]GTTGATGCACGCGGT GTTGCTGGTATTGAAATAAGCTCTGTTTCTGGTCT
solcap_snp_c1_13079 PGSC0003DMB000000184 1149052 ATGGAAGGTGGTCGTGGTTGGCTTACAGAAAGGAC CCATGCCATAGTGGC[G/A]TATGTTATGGCTGTC ACTGCTCCAACGAGGGAGAGTCCAGCGATGGAGTT
solcap_snp_c1_13085 PGSC0003DMB000000184 1014816 GTAAAAATGCACCGATTTCTGATTCGCGTAAAGGA ACTATTTCTGGGCAA[C/T]TTGGCAAGCTTGTAC TGATGAGCTTCTCGCATTTCAGGAGGAAGTTGAGG
solcap_snp_c1_13099 PGSC0003DMB000000144 840314 CTAAGGATATATATGTAGATGCAAATGAGAGCTCA TTAGCAATTAGAGTA[A/C]AGCAATCTGGAATTG TTCGGACTCTCATGGAAACCAGTACTCTGTATGAG
solcap_snp_c1_13116 PGSC0003DMB000000144 830495 GATAGGGCAACTAACATCAAGTTGCATCTTGAAAT AGATTTTAATGGACC[G/A]AATAATTGCAAAGTG GATGAAGGTGTGGAAGAGTCAAATGTCCGTGTTAA
solcap_snp_c1_13124 PGSC0003DMB000000107 830121 GAGTGAGAGAGAAGAAGAAGAAGATGTTAGGAAAA GAAGAATCGAACATG[C/T]TGTTGACGTTGCTCA AAGCCGGAGATCATCGTCCGTTCGATGAGATCGTC
solcap_snp_c1_13125 PGSC0003DMB000000107 830092 GGAAAAGAAGAATCGAACATGCTGTTGACGTTGCT CAAAGCCGGAGATCA[T/C]CGTCCGTTCGATGAG ATCGTCGCCGACTTCACTTCCAGTTTCCCTCCCCA
solcap_snp_c1_13135 PGSC0003DMB000000180 572701 TCACCAGTGATTTGTCAGTTGTGGTTTCAGCATGA ATCTTGTCTACATTT[T/C]CTAAGGGCAACGATG CTGGTTGATTACATGGAAGAAGTGCTCTCCCAACA
solcap_snp_c1_13155 PGSC0003DMB000000180 705734 AAAGCTGTTTATACTGGTTGTAGATGAGGAGTTGT TGCCCGTCCTGGTGT[C/T]GTCAAAGGTTCTGCG GCCGGTGCAGGTCCAGGTGCGACTGTGACATGCAA
solcap_snp_c1_13166 PGSC0003DMB000000226 871529 GCGACATTTAAGTTGATGACACTTTTCATCAAGAG ATCTTCTTTGGCCAA[G/A]CAGTAAGTGTGGCCT TGGTGAAGCAAACACACATTTGGGCTCCAAAATAT
solcap_snp_c1_13172 PGSC0003DMB000000226 997067 CTAAAACAAGCTTTGTGATAGATTCTGTTATCTGC AGTTAATTTGTCAAC[C/A]AGATAGACAGTCTTG TCACAAGCCATGCACTTTTGTGTTGTTCCTGCAAA
solcap_snp_c1_13186 PGSC0003DMB000000646 186474 GTTATTGTGGGAGGTCCCAAAGTAAGAGTGGCAAA AGCACAAAAGGCCTT[T/C]GTGGAACTTGCTGAT GCCTGTGGCTATCCGTTGGCAGTAATGCCATCTGG
solcap_snp_c1_13187 PGSC0003DMB000000646 186519 GCCTTTGTGGAACTTGCTGATGCCTGTGGCTATCC GTTGGCAGTAATGCC[A/G]TCTGGCAAGGGACTG GTACCAGAGCACCACCCTAGTTTCATTGGGACATA
solcap_snp_c1_13189 PGSC0003DMB000000646 187375 ACCTGGAAGCTTCCATCACCGATGCAGGCAATGAT ACGTTTATCTTTAGC[A/T]GCCTGAGCATAACCG AGAGTGGCACCGACTGACCAGCCAATGGATCCATA
solcap_snp_c1_13229 PGSC0003DMB000000208 438794 TTCTTTGATAAAAGGCTGAGATTTCCCAGTCATTG GCACATTTTCTTCCC[T/G]GCTCATATCCATCTT TTTACTTCCTTTAACTGAGCTGCTATGTGCACGTA
solcap_snp_c1_13230 PGSC0003DMB000000906 2955 GGGAGATCAAAAATTGTTTGCAGTGGCCCAGGTTT CTGATGAACTACAGT[A/G]GGCCCTTCTTTATCC AAAGCAATCCTTCTACGAGTATTAGCACAGCCATT
solcap_snp_c1_13233 PGSC0003DMB000000265 699468 AGATCATAAACTAGTATATTTTACTAAACATATAC TTCACGTCATGTCAC[C/T]GTGGGATGCAAAAAG ATGCAGGCCCATCTGCCTTTTTATATGGTCTGGTA
solcap_snp_c1_13236 PGSC0003DMB000000265 648349 TCTGTAATAAACGTTGAGTCAGAGCTCAATGCTGT CAAGTCTAAGAGTTC[G/T]GCTAAACCCAAGAAA GGTTCTAAGTCAACCCCTAAAGTTGGCGGTTCTTC
solcap_snp_c1_13240 PGSC0003DMB000000265 824939 GTGTGAGAAGGACCATGAAATGCAGCAGTGGTGTA TTCCCTGAAGTACTC[G/A]GGAATAGACAACCCG AGGAAGAGAGAAACACCAGCGATGAAGAGGTTTCT
solcap_snp_c1_13243 PGSC0003DMB000000506 147253 AATCCCGTTAACATGGTAGAGATAGATCATTCAAT AAGAACGAAATAACC[A/G]AATCTTATCTGAACC CTTAATCGGCATCCATCTCCTCAAGTGCAGCTTTA
solcap_snp_c1_13246 PGSC0003DMB000000506 192319 ACTATGAGATTTCAACCCAACAACATCTGGCCAAA TAGACATCTCACATT[T/C]GATTATCCGATTCCA TGGAGCCTAACCATGAGAGATATTCTGGTGTCTGA
solcap_snp_c1_13268 PGSC0003DMB000000506 235784 TGCTTGCAGCAGCAGGCTAGCTAGTTCTGTTGAAC ATGCTGGACATTCCG[A/C]TCTGAGGAGTGAGTT TATTTAAGGCTGGCACAGCTATATCCTAAAAATTT
solcap_snp_c1_13289 PGSC0003DMB000000412 56048 CAATCTGATGGATTTGAATACCTTAAGGAAAACTG CCCTTCTCTTCAGTC[G/A]GAGCTTCTTAAAACC GTCGCTGGTTGTGAGGATGATTGTAGCAGTGGAGG
solcap_snp_c1_13293 PGSC0003DMB000000412 55756 GGTATCGACTTTCCAGAATCACGTCTTAACCCTAA ATAGTCTACTGAAAC[C/T]CAAACTTGGTGTCAG CAAAAATGTTTAAAAACTCAGTATGGATACTGGTA
solcap_snp_c1_13296 PGSC0003DMB000000412 38008 CTTCCAGGCAATGCAGCAGCAGCCACACCAGGTAC GAGCCTTTTCTCACC[G/A]ATGAAAGTGCCATTC GTGCTGTCTAAATCAGTCACAACGAGATAGTCCTC
solcap_snp_c1_13304 PGSC0003DMB000000412 180228 AGCTTGGATTGGACCTGCTCAAACATCTTCTCGAC TCTAACGAGTGGGGG[A/G]GCCCTCCTGACTTGT GGAGATTCCTCAAAAACATCAAATGGGTCTTCCAC
solcap_snp_c1_13318 PGSC0003DMB000000412 129994 ACAACAAAAACTTCTCCTATTGCTTCAATTTACAG GCTCTTCTGAGCCTT[G/A]AGACATGTCAAAAGA TGTGGAGAACTCAGGTTGATCACCAATATTGCTAC
solcap_snp_c1_13349 PGSC0003DMB000000032 1091811 AAAGCCAAAGAATCAAACCCAAGTTGCCAAGTTCA GGTCAAGCGCCGCAC[G/T]GATGACCATCCACCG CAAATCTCTGTCACTTTCGTCAATGGAGTCGAGCA
solcap_snp_c1_13378 PGSC0003DMB000000652 77504 GTCACCCTTTCGTGACTGGTTAAGCTGATAGAATT CGTTCCTTAGAGTGG[A/G]CGAGTCTTGCGTCCA GATGCACGGCCACAGAGAAGAGCACCTATTGGAAT
solcap_snp_c1_13385 PGSC0003DMB000000652 204388 CCATCAATCATGGTGGTGTGGGAATCTGTTCCGAC CACGCTATCTGGGTA[A/G]AGCAAGCCTTCCCTA TTAAAGACAACCCTTCCAAGATATTCAAGATTCAC
solcap_snp_c1_13395 PGSC0003DMB000000138 470286 AGAGCTCAACTCCTTGACCATCATAGCAGATCCAG AGCTTTCATAGGAAC[C/A]TATAAGTTTGAGTCG AATAAAAAACCCTTTGTTTGCATATGTGACTCAGG
solcap_snp_c1_13396 PGSC0003DMB000000185 493794 TTTGTACTTATCCTTCCTTTCAACCTCATTTTCCC ATCCACAAATATCAT[T/C]ACCGATTTCATCTCT CTCCTCATTTCCAATTTCACTTTCACTTGCTGTCT
solcap_snp_c1_13422 PGSC0003DMB000000255 116553 CGGGCTGTTGGGCTCACTTCGTGCTGTCTGTATGG AAATTCTCCTATGGG[G/T]GCACAACAGGCTCAA CTAAAAAGAGGAGTTGACATTGTAGTGGGTACTCC
solcap_snp_c1_13429 PGSC0003DMB000000035 155182 TCTCATCACAATCCATCCAAAATGAACAATTATCA AGGAGCTGGTGAGTT[C/T]CAGTGTTATGATAAA TACATGCTGAGTTCTCTCAAACAGTATGCCGAAAG
solcap_snp_c1_13430 PGSC0003DMB000000035 155202 AAGGCGAGCTTCGCTATCCTTCTCATCACAATCCA TCCAAAATGAACAAT[T/C]ATCAAGGAGCTGGTG AGTTCCAGTGTTATGATAAATACATGCTGAGTTCT
solcap_snp_c1_13459 PGSC0003DMB000000528 70803 TATGATTATTCATCTCATATTTAGACAAATCACTC TGATTGACAGCGTTA[T/C]GGTACAAGACTATGC TTGATCACGGTTTACAACACAACTAATTGCCACTA
solcap_snp_c1_13465 PGSC0003DMB000000528 24691 TTGAGAAATTTTGTTCGGTCTCTCTCACAAATTTA AATGTGTATGCATGT[T/C]TAGTCTGTGGGAAAT ATTTTCAAGGAAGGGGACCAAAATCCCATGCGTAT
solcap_snp_c1_13472 PGSC0003DMB000000528 183669 ACTGCTCCGGGATTAAATATCCTGGCAGCATGGTC CCCAGCAATGTCTAA[T/G]TTGAACTTCAACATA CTCTCTGGAACTTCCATGGCTTGCCCTCACATATC
solcap_snp_c1_13481 PGSC0003DMB000000262 266840 TCCTGCAGCTAGCCATCCCCCTGTCCTAGACTTAT CGACCGGGTTTCCTC[G/T]AAAATCAACCAGATT ACCATCTTCTGCACCATCTTTTCCAGCATGGTTAT
solcap_snp_c1_13482 PGSC0003DMB000000262 107170 CTCGGTTCTTAACTTTATGATCACAAAAGAACATT TTTTTAAGTATCCAA[G/A]TCTTCCACCTGGGTT GTTGTCACCTCTACGTGCTGCAAATGTTGACACAG
solcap_snp_c1_13483 PGSC0003DMB000000262 107316 CAAGATGACAAATCACAAAATGTTGAGGAAGTACA GAAAATCATAGGGTA[C/T]GACTTTAATGATCGG AATTTATTGCGGCAAGCTTTTACACATACGTCGTA
solcap_snp_c1_13506 PGSC0003DMB000000159 617345 ATCTGATCCTGTATTACTTCACTCTCACTTTGGAT AGTACTATTCAATTT[C/T]TCATTCTTCAGCACA AAGCAAACCGCCAACCTCGGCTTTCTTCGAGACAG
solcap_snp_c1_13506 PGSC0003DMB000000400 367540 ATCTGATCCTGTATTACTTCACTCTCACTTTGGAT AGTACTATTCAATTT[C/T]TCATTCTTCAGCACA AAGCAAACCGCCAACCTCGGCTTTCTTCGAGACAG
solcap_snp_c1_13515 PGSC0003DMB000000110 1286850 CAACCAAAAGGTAGGGTGCACAGGACCGATTAAGC ACGCCTTTCCTCCAG[G/A]TTTCAGAACCCTGTA TGCCTCTCGGATTCCACGTTGTGGGTCCGGCCAGT
solcap_snp_c1_13524 PGSC0003DMB000000542 97400 ACGAATTGCTAAATATGCCTTTGAATATGCATACC TCAACAATCGCAAGG[T/C]AGTGACTGCTGTGCA CAAAGCAAACATTATGAAACTTGCAGATGGTTTAT
solcap_snp_c1_13526 PGSC0003DMB000000542 43491 GACAAAACAAATTTTAGCTTGCATCTTCAAACATA GTTGGGATTTGACGG[C/A]TAAAATTGAAGCATT GCAAAAAGTTTCAGTTGCAATGACTCAAAAAGCAT
solcap_snp_c1_13530 PGSC0003DMB000000542 171894 CAATATTTTGACAAGGATGGAAGTGGTTACATAAC GGTTGATGAGGTCCA[G/A]CAAGCTTGTATAGAG CATAACATGACAGATGTTTACTTTGAGGATATTAT
solcap_snp_c1_13531 PGSC0003DMB000000542 171879 CTCATGGCCGCATTTCAATATTTTGACAAGGATGG AAGTGGTTACATAAC[G/A]GTTGATGAGGTCCAG CAAGCTTGTATAGAGCATAACATGACAGATGTTTA
solcap_snp_c1_13584 PGSC0003DMB000000306 660234 AACCCTTCCTCCACTGATAAACCTCTCGATCTGCA GCTAAGATTCAAGAA[A/G]CACCAACGATGGAAA CTCACTCTGACGGCACAGATGAAATCGCCGCCGTG
solcap_snp_c1_13586 PGSC0003DMB000000306 666303 AAGCGTGTTGAGGAGATTATTTGGGTTAAGACCAA TCAACTTCAGCGAAT[C/T]ATCAGAACTGGACGG ACAGGCCATTGGCTCAATCACAGCAAGGAACATTG
solcap_snp_c1_13594 PGSC0003DMB000000282 128049 GATTAGATTGGCATTACTATATAGTAGTACAATTT TCTGTTGCTTTCATC[T/G]TTTGTTAGCTTCATT TTGTTGGTTCTAAAGTTTTGATAAAACATTGGATT
solcap_snp_c1_13599 PGSC0003DMB000000227 411191 AATAATCTTCATGAACTCTGGGCACTGCTGAACTT TCTGCTGCCTGAGAT[C/T]TTTAGCTCAGCTGAG ACTTTTGATGAGTGGTTCCAGATTTCTGGTGAGAC
solcap_snp_c1_13603 PGSC0003DMB000000285 70250 TGGGCCGCCAACACGGCCCACTTCACATGCAGGCT CGTCGGAAGAGGAAC[G/A]TAAACTGCATCCACT TCCGGATCATCCAGAACCGCCTCATAACTGCCGTA
solcap_snp_c1_13612 PGSC0003DMB000000207 203282 TGGTTAGTCACCCATTGGCTTCTTGCTCCACTTGG GTGCACCACTAGGTA[T/C]AATGCCACAATCAAT ACTATCTTCGGAATGTTATGTATGTCCATCTCCCT
solcap_snp_c1_13626 PGSC0003DMB000000189 154192 CCATTTTCCACTGTAAACAACTATCTCGATACAGC AGGGTAAGAGAGTGG[G/A]GGTCTTATGTCATCA TAGTTCATATATCCCACCTCTTCTTCGCGCGGAAC
solcap_snp_c1_13636 PGSC0003DMB000000504 231064 TGGGTGAGAGAGAATGAGGGCAAGGACTCCATAGA AGAAGCCCTTGCTTC[G/A]TCATTATTGCCATTT TTCTTCTTTACTTTGCTTCAGTTTGTATGATTTTT
solcap_snp_c1_13638 PGSC0003DMB000000504 275358 ACCAATCTTGACTTTTCATCTGTTCTGCCTTATGA TGAGCATTTGGCACC[T/C]GCAACTTTCATTTCT CAGCCAACAATTAATGAGGCATCAATTCCATTAGC
solcap_snp_c1_13641 PGSC0003DMB000000504 275960 GCTGTTGTTCCTGCATCATCCACTGGGAGTGGTTC TTCATCGAAACAACG[G/A]ATGCGTTGGACACCA GAACTTCATGAAGCCTTTGTGGAAGCAGTCAACAA
solcap_snp_c1_13644 PGSC0003DMB000000504 42448 CTTACTTGTACTTCTCCATTATTCTCCTTGCTTCT TCTAGACTATCGTCA[G/A]CAGAAGCAGTGCCTC CACTGCCTTTTGGACCATCGTCCTTGTTCAAGGCT
solcap_snp_c1_13651 PGSC0003DMB000000192 657244 CTGATATGATAGTTGTTCATCAGCGCTTTGTTCTT CAATTTCCTGAAAAT[C/T]TACCTTCTGATGCTG GGGCACCTTTATTATGTGCTGGAATCACTGTGTAC
solcap_snp_c1_13652 PGSC0003DMB000000192 737720 CCAACAAAATCGTTCCCCAAGAAATCAATTTCAGC TGTAATTCCTTTTGC[C/T]GCTGTACCACCCCAG TCTTCACAAAACAACTTCCAATCATCGTCGGTGAT
solcap_snp_c1_13658 PGSC0003DMB000000047 1941740 TCTCTTCATCTGAGATCATATTACAATAGAGAACA AAAAGAATTCAAGCT[T/A]ACAGAATATCATAGA TGATATAAACAAACAATTCTCCGATACTTCATATG
solcap_snp_c1_13658 PGSC0003DMB000000487 31790 TCTCTTCATCTGAGATCATATTACAATAGAGAACA AAAAGAATTCAAGCT[T/A]ACAGAATATCATAGA TGATATAAACAAACAATTCTCCGATACTTCATATG
solcap_snp_c1_13663 PGSC0003DMB000000047 1838059 AGTGCTCCTTGATCATGACGTGGTTGTGAAAAGGG ATCTAAGCGGACTTT[T/G]GCGCATCAACATGAA GGGTAAAGTGAATGGTGCGGTGGAGACTTGTCTTG
solcap_snp_c1_13671 PGSC0003DMB000000047 1834177 CCAAACTGACATTCTTAGGTTGACCAAGACTATCA TTCTTATCAATGGTA[A/T]ACAAACTGACTGCAG AAATTTGGTTTCCATCTCGGTAGACATCCAAGATT
solcap_snp_c1_13681 PGSC0003DMB000000305 690787 CACCAGCTACCTCCCTGACTCTTTTATAATGGGGA AGGTCTAATACTCTG[G/C]TCATACCCTTATCCT TGTGTAGCTTAGCTTCAATCACAAATTTATCAATA
solcap_snp_c1_13682 PGSC0003DMB000000305 691994 AAGGTTTTTCACAAGGATAAATGTCCTCCTGAATT GGTGGTACCATCTGG[G/A]AAGAGCATAGCAAAA AAATGTAAGGGACTACCCCTTGCGATTGTTGTTAT
solcap_snp_c1_13683 PGSC0003DMB000000305 693453 CAGCTGATGACTTTCCAAGACTTAAGCATCTTGTT CTCATCTGCTGTGAT[T/A]ACCTTAAGGAAGTCC CCATCGCCCTAGCTGATATACGCAGTTTCCAAGTC
solcap_snp_c1_13686 PGSC0003DMB000000068 110540 CAGCCTGGTGGCCCGTGTAAGAGTATCCCTGACAT AGGCCTAACTCCAAG[A/G]TGCTTAGTCAGCTGA GGATGGTACAATGGAACAATCACCTCCATTTTCAA
solcap_snp_c1_13697 PGSC0003DMB000000114 1451237 CAAAGGTTGGGTTGGGGGTAGGGGGTGAGGGTGGG GACTACATGATAATG[G/T]AAACAAAGATAACTA GACTTTACCTCATGTACTACAACACTATCACTAAC
solcap_snp_c1_13698 PGSC0003DMB000000114 1600264 CAAATGCAATACAAGAATTTAGGCAGATCAGGCCT AAAGGTATCCCAGCT[T/C]TCTTATGGAGCATGG GTTACCTTTGGAAATCAACTTGATGTCAAAGAAGC
solcap_snp_c1_13742 PGSC0003DMB000000048 1090889 GTAGTGAAGATGAGTATATTAGGAGACATCATAGA CATGATGTTAGAGAT[A/G]ATCAGTGTAGTTCAT CACTTGTAAAGCATATTAAAGCTCCTGTTCATCTT
solcap_snp_c1_13754 PGSC0003DMB000000511 205602 TCAGAAATTTCATTTAGAAGACAAGGTTCATCAGG TTTAATATGGGATGA[T/C]AAATTATTATCCGGA GAACTCAAGAAAATTGATCAAGAAGGTGTACAAGA
solcap_snp_c1_13762 PGSC0003DMB000000511 281443 AAACAATTTGAATGCCTATAACTTGTGTCACACAT AAAAGGACGACAGCC[C/T]TTCTCATGAGAGGCA CACAGAAGGAGAATAGCATTATGAGGATGTTCCAT
solcap_snp_c1_13764 PGSC0003DMB000000511 103265 CTATTCTCGTCTTCGTAGTGTATGTGTTTCATGGT AACTTCAAGAGCTTT[A/G]TTTCTCAGCTTGTTG AAAGGCCAACGAGTCAATAGAGGCTCGGTACATAT
solcap_snp_c1_13764 PGSC0003DMB000000140 1443088 CTATTCTCGTCTTCGTAGTGTATGTGTTTCATGGT AACTTCAAGAGCTTT[A/G]TTTCTCAGCTTGTTG AAAGGCCAACGAGTCAATAGAGGCTCGGTACATAT
solcap_snp_c1_13765 PGSC0003DMB000000511 103276 TGATGTATCGACTATTCTCGTCTTCGTAGTGTATG TGTTTCATGGTAACT[T/G]CAAGAGCTTTATTTC TCAGCTTGTTGAAAGGCCAACGAGTCAATAGAGGC
solcap_snp_c1_13765 PGSC0003DMB000000140 1443099 TGATGTATCGACTATTCTCGTCTTCGTAGTGTATG TGTTTCATGGTAACT[T/G]CAAGAGCTTTATTTC TCAGCTTGTTGAAAGGCCAACGAGTCAATAGAGGC
solcap_snp_c1_13767 PGSC0003DMB000000511 160244 GGATCACAAGCTGCATCAAGGAAAATTAGCAAGGA TGAACTCGGAAATGT[C/T]GCTGGAATGGCAGCA AATGCAACAGCTAGTGGCGGAAAATTTGACAAGAA
solcap_snp_c1_13769 PGSC0003DMB000000141 1314994 ATAGCAGCTGCAGCTCCTCTGTAATACATTGGAGC TAGACTGTGGTATCT[C/T]TCTTGGCCTGCTGTA TCCCATATTTCAAATTTTACAGTTGCATCATTTAC
solcap_snp_c1_13782 PGSC0003DMB000000059 81378 AAATGTAAGTTGCTGGACTTTTCATGTTTATCCTG AAGAAACGACGGGTA[G/T]ATCGACACCGTATCT TCCATATCTCTTCTCCTTCCACATACAGATGTCAT
solcap_snp_c1_13783 PGSC0003DMB000000557 50666 TCGAGAAATCTTCACACAACAATGGGGGATTTCAA TCTCGCCTTGGTTAT[T/C]GTAGCCATAGTCGTA TGTATTCTCGTTTTCATATTCAATGTCTATCTTCT
solcap_snp_c1_13785 PGSC0003DMB000000557 45146 CTTTTGGGCACTGCAGCTTTTGCATTTTTTTGCTT CTACCTTCTGCTTGC[G/A]GTGATTGCTGGAGCA ATGATGATTGGCTTGAGATTAGTTTTTGTTACGAT
solcap_snp_c1_13786 PGSC0003DMB000000557 45137 ACTGCAGCTTTTGCATTTTTTTGCTTCTACCTTCT GCTTGCGGTGATTGC[T/C]GGAGCAATGATGATT GGCTTGAGATTAGTTTTTGTTACGATTCACCCAAT
solcap_snp_c1_13805 PGSC0003DMB000000222 381614 ATGCCTGGTTACCAACCCCTCAGAGATAGAAGATA TATCATCAAAATCTA[T/C]TACAAAGCTGTTTAA GCTTCTGGATAACATGGAGGATGCTGGTATTACTG
solcap_snp_c1_13809 PGSC0003DMB000000140 1284573 ATACATTTACCCTCTCTTTCTCTCTGTATATTTCA TTTCTTGCTTCATCT[T/C]TCTCTCTTGTTCTTT CTCCTCATAGATTTTCAAGAAAGCTTGAAGGAATG
solcap_snp_c1_13810 PGSC0003DMB000000239 406106 TCAGAAGGAGCCATTACAACCATATTAGGAAGACA TGCCATGTAAGTAAC[G/A]TCAAATGCACCACAA TGTGTTGGACCATCTGCTCCAACAAGACCTGCTCT
solcap_snp_c1_13843 PGSC0003DMB000000159 148340 GGTTCAATCCAAGAAGTGGAGGAAGAGGTTGCCAT GTTTTGCCCTGTGAT[A/C]TGCCGGGAATTACTT CAAAATGGCAAGGGATCTTCAAAAAATTGTGCAAT
solcap_snp_c1_13847 PGSC0003DMB000000159 144343 CTTGACTCTGTCTGGCCAGAAAGGATACAACAGAT TTTGTCGTTGGGTCA[G/A]GAGACGAGACGGCTT AGACCAATTTCCATGAATGGAAATGGTTCCATGAA
solcap_snp_c1_13859 PGSC0003DMB000000322 196907 TTCCCAGTTGTTTGTTGATCCAACCTAGAAGGATA TCAGCTGTGCGTCCT[C/T]TTTCAATGGTGAGTA TTTCACTATTTTCTTGTTTTGGATCCCAACCAACA
solcap_snp_c1_13860 PGSC0003DMB000000322 110597 CTAAGGTCCCGTTACAATGCAGACACAACTGGGGA AAACAGTGTGTTGTT[G/A]GACATGAATCTTTTA GAAACATTGCGTACCAAACCTATATTTCTTGGAAG
solcap_snp_c1_13863 PGSC0003DMB000000669 209406 AAAATCATCCGACATACTCGGTTTTCTCACCAACT TTCCTTGTATTCGTA[G/A]TCCTTTAGATGGTTC ATCCACAGCAATAACTGGTTGAGATTTTGCACAGC
solcap_snp_c1_13871 PGSC0003DMB000000279 512571 TTAAAATTGAGCCCCTTCAAAAGTTTGTCCAAATT GCCAATTAGTTGGTG[C/A]AGCATTGTTGCTAAT GAGTGTCCTTCCATCACTTGTAGTGACTTGAAATG
solcap_snp_c1_13883 PGSC0003DMB000000384 147398 CGCTTGAATTACTCTGATGATATGGAAAGCAACCT AAACAAAACTTTCTC[C/G]CTACTAAAAGCTCGG GGCATGATCAAGTCAGGTGACCTCATCATTGCTGT
solcap_snp_c1_13884 PGSC0003DMB000000384 224133 AAGAAAGGTTCATTATCAGGATTTATTATAAGACG ACCAATTAATTCAGC[G/A]GCAGCACAATGCCAG GCCTTAACAGCAGATCCTAGCACTCCCATGACGGC
solcap_snp_c1_13885 PGSC0003DMB000000384 222942 GGCATAAAAGAGAAGTTGCGAACAACGTTTGAAGC AGCAACAGCAAACTG[C/T]TGTTTTTCAATCCGC CCCTCCTCATCCAAATTAAATAGGCCATCTTCCTC
solcap_snp_c1_13886 PGSC0003DMB000000384 222352 TCGCATCCCTGCGGACTTCGTCTTTCTCCTTGAAT GATAGCAGAGTGAGG[A/G]TATTTAATGCCCATG TCAGCTCCCTCTTTAATCCACTTTGAAGAGCTAGA
solcap_snp_c1_13887 PGSC0003DMB000000386 462523 AGTACTTTGTTAACCACAATAGCTGATGCTGGTGT CCCTGCTGGATATGT[C/T]GATCCTGCTAATGGT ATTTGCTCTGAGTTGCAATTCTTTGTTGATGCCCC
solcap_snp_c1_13910 PGSC0003DMB000000552 154578 TGAAAAAGATTTGTAAGCAACAAAATCACAGGAGA AAGAAACTGTAACAT[C/T]CGTCTGCCCTGCAGA TCTTCCATGCAATACTTGAATAAAACCAAGGTCAT
solcap_snp_c1_13911 PGSC0003DMB000000552 185964 CACATTCACTCCCATTAAAGCCTTAGGATAACAAG TCCCTTCTCTCAACT[C/T]AATCATGTTCTTCTC ACTCCTTTTCTTTATCTTTTACAAAACCATCCACC
solcap_snp_c1_13912 PGSC0003DMB000000552 47225 GGGTTGGTGTAGAGGACATAGTGAACCATATCTTA CAAGCTTGGGAAGTT[G/T]CAACAGGCAATAAGA AGCGGTGAAATGTTAATCGAAAACTTTACTTGAAC
solcap_snp_c1_13920 PGSC0003DMB000000552 306453 AACGTGCATTTAACTATTACATGAACAATGCTGAG ACTTGGAAAGAGCTT[G/A]TTCAGAAGGATATGA GCATAGATTTTAGTTGGGATTCATCAGCATCACAA
solcap_snp_c1_13923 PGSC0003DMB000000552 51607 ACCGTCCACCCTTCTGCTGCTGACCCCAATTATTC CCATCTAGAGATCCA[T/C]CGTGCCAAGAAGAAG ATAACTGCCAAGAACGTTTTTTCGTCTAAGAATCA
solcap_snp_c1_13929 PGSC0003DMB000000552 92633 GGAGCCAAAAAATCCAGTGAACGCCGAAATCCTGT AGCACATATTACTGC[A/G]TCTGAATCATTCCCA ATGGCATCAGCTAGTCTTGCTGATCCCTCTGTGAC
solcap_snp_c1_13941 PGSC0003DMB000000204 35011 CTGCAGGCCGTTATATTACTTATCGTTATGTGGTT TGAACTAGTTTTTGA[T/C]GTCTTCATCAACTGA AATGTAAGAAGTTGAGAGAGTGATCATGTAATGTA
solcap_snp_c1_13951 PGSC0003DMB000000150 1319061 TTTGGTGCAGGTACCAGGAACTGGAAGCAGGTTGC TGGAGCAACAGGTCT[C/T]GTGTGTCTCTTATGT CATGTTGCTGAGGACTCCCGATAAACTTTGACTCT
solcap_snp_c1_13954 PGSC0003DMB000000625 50421 GTATCGTCTGAAAACGATACATTATGGAGGAGTTG GGTGCCTGATCGGGG[G/T]TACTTGACACAGCCG GATTTTGCAAAGTCCTTGTCGAAGATTGGATCTGT
solcap_snp_c1_13962 PGSC0003DMB000000083 528851 TCCCACTGATGTATTGTTTCCATGATTGAATGAAG GCGGCGATGAACTGT[T/G]GAGGTAACTGGCATA GGGATCATAGGCATTAGGATGTGGTGGTTGCTGAG
solcap_snp_c1_13996 PGSC0003DMB000000130 393395 CAAAGACAGCTACCAGAACGACTCCAAGTCGGAAA GCTGCACCAAAGGCA[G/A]CACCTGCCAAAAAGG AGCCGGCTAAGAAGGCACCTGCGAAGAACGTGAAG
solcap_snp_c1_13998 PGSC0003DMB000000138 1125433 CTGGTCACTTTGTATTTATGGAGAACACATCGGCA TTCCATTCTGCTGTA[A/C]TCTATGCTTGTCGTA GATTTATATCACCAGAGAACACCAATGACTCGCTT
solcap_snp_c1_14038 PGSC0003DMB000000632 113573 TATATGTTGAGAGCAGAGTTTAAACTTCCCAGCAT TACAGCAGAAGAAGC[A/G]GTTCCTGAAAGAAAA GCTCCTATACGTGTGAAATTTGAGATACCATATTT
solcap_snp_c1_14039 PGSC0003DMB000000632 113358 TCCAACTGATGCAACTAATCCAGATGTTCGTACAT CAATGGGATCATCTA[C/T]TTATGCACCTGAAAA GGATGCATTGATTTGGAAGATAAAATCTTTTCCAG
solcap_snp_c1_14044 PGSC0003DMB000000173 1093825 GCTGCACTGATGGAATACTGATTTTCCAGTCTTGG ATCCATGAGCATACC[G/A]AATTTCCGGCCATCA GCAGGGTAACGTTTAATCCAATCCAGAAGTTTATG
solcap_snp_c1_14045 PGSC0003DMB000000485 175145 GAGAATTGTTGAAGCATATAAGCATTAGGTGTAGA TTCCAAAAGATTATA[A/C]GCTTTCTTAATAGTT CCTCCCATTCCTTTAGTTGGATCAGTGATCACTAA
solcap_snp_c1_14046 PGSC0003DMB000000485 175141 ATTGGAGAATTGTTGAAGCATATAAGCATTAGGTG TAGATTCCAAAAGAT[T/C]ATAAGCTTTCTTAAT AGTTCCTCCCATTCCTTTAGTTGGATCAGTGATCA
solcap_snp_c1_14047 PGSC0003DMB000000485 172850 TACATCCAAGTTTTGGAGAGAGGTACTTGTCATCT GTTCTGTATGAAGAT[A/C]TCAGGAAAGAGGCAC AGAATATGCAACCTGTATCAGTTGATTAATGGTCT
solcap_snp_c1_14048 PGSC0003DMB000000485 28675 CATTTCCTTCAAGATGTACTGCAGTCCTGTACCCA TAAGTTCTTTTAAGT[T/G]TTGAATCAACTTTAA ATAGTTGTTTCGTTGAAATGCCTTTGGAATTATTA
solcap_snp_c1_14053 PGSC0003DMB000000485 234293 TGTCCATCCATTCATCTCTAACCTTACCGAAAAGA TCTATAAGAAAATCT[T/C]TGTCTTCATTCCATT CTGCCATTATAATGGGTTTAATCTTTGCCCAGTTC
solcap_snp_c1_14083 PGSC0003DMB000000324 560119 AATATTATTATCAATAAAGATGATTGCAAAACCCC AAAATCTTCCCCTTT[T/C]TTAATCCCAAAAATT CTCAAATGTCCAGCTGCACCTAAAAAACCCAAAAG
solcap_snp_c1_14084 PGSC0003DMB000000324 560329 ACGCGATCTTCCAATTCAACTACTTTAATCATTTC CGAGCACCTCGTACC[T/G]CAAATTAATCGATTT GATCATTTTCGAGCACCTCATATCTTTTTCGAAGC
solcap_snp_c1_14086 PGSC0003DMB000000236 502628 CGAGTTTCAATTCCCATTTTAAGTGTCATTGTTGA ACTTGGACAAGATCC[A/G]CATGCTCCTTGAAGC TTAAGAATTACAACTAGGCCATCGATCTCATGTAG
solcap_snp_c1_14089 PGSC0003DMB000000010 3682235 CTCTTCTTCAATACCATTGCTGTGACTGTGATGGT TGTTGCCAAATTCCC[C/A]AATATGCACAAGGTC CGAATCTTCGGAATTAATGGGGATCCGTAAATGGT
solcap_snp_c1_14108 PGSC0003DMB000000487 188341 CAAGCAGGTGCAAGGAAAGTTTATGCAGTCGAAGC CACCAAGATGGCAGA[G/A]CATGCTCGTGAACTT GTTAAAACCAATGGATTTGAGCATGTTGTTGAAGT
solcap_snp_c1_14127 PGSC0003DMB000000243 899658 AAAGATCCAAGGGTTTGTTTTGTCATTTCAGAAGC AACAGAGATCATAAG[A/G]TCCCTAGAAATTCGT GGTCTCCAGCTTGTTGGCTGCTTGAAGAACAACTT
solcap_snp_c1_14142 PGSC0003DMB000000378 379157 TCCCTGATCCACTCAGAATGCCTATGCTTTCTCCT GTGCCACCTGTCTTC[G/A]TTCATGTACCTGATA CCCAGTTGCAAATTAGAATAGTGAACCAGATGGAT
solcap_snp_c1_14166 PGSC0003DMB000000132 498460 ATCAGGTTTTTCCCAAAAACTGCAGCAACCACTGG GTATGATATCTACAA[G/A]TCCCAGTTTTCTGAA GAGTGATTATTGATAACTTCTGTACTTATTGTCTA
solcap_snp_c1_14174 PGSC0003DMB000000258 639630 GGATGAACCGCTTGTTGTGGACCTTACCTGGATAC CAGGTTTCTTCTGCA[T/C]TGCAGGCAAGGGAGG TATTCCAATTGGCTCACCAGCATCCTTATCTTGAA
solcap_snp_c1_14197 PGSC0003DMB000000078 772160 CTTTCCCAATCTTGTAACCCTTCGGTTGGCATCAG TAACCTTTTCAGAGC[A/G]TTGTGTTATCAAGGC CCCTCTTCTTGCTAATTTGACCTTGAACTGTTGTG
solcap_snp_c1_14205 PGSC0003DMB000000339 553228 CAATACATCAAGAATGTATTTGCAAAGTACGAGTT GAAGCCCATTAAGAC[A/G]TGCCAAACTGCATGG CCCTGTGGATTAACGTACCAGCCCTGGATTTGCTT
solcap_snp_c1_14211 PGSC0003DMB000000412 420055 CACAAATCTTGTAAAAAAGAAGATGGCACTGATGA TGAGAAGAAAGGGAC[A/G]CAATTGTTGGAGGTA TATGCAATTGAGATTCAAATGTATACAGAGACAAA
solcap_snp_c1_14213 PGSC0003DMB000000016 187873 GAAGATGTAGAAGAATCGGGAGAAGAATGGGTGGA TGAGGAAGATAGTGA[C/T]TCTGTATGTTCTGAG CCACTATCTCCTCGGTCGGATGACAGCTATGACAA
solcap_snp_c1_14219 PGSC0003DMB000000035 2478551 TTGATACAAATACTTCCTTTTTGCATCGACACAAG TCGTTTGTTTGCACA[C/T]GACTTCAACCTCTGC CCTGGTCAAGAAAATAATAATTGATAATAGACTGT
solcap_snp_c1_14236 PGSC0003DMB000000008 2930237 GGTCGTGTCCGTACAAAAACAGTGAAGAAATCTTC ACGTCAAGTGATCGA[G/A]CGTTACTACTCAAAA ATGACCTTAGATTTCCACACAAACAAGAAGATTCT
solcap_snp_c1_14238 PGSC0003DMB000000200 391378 AAGGATAACGGCGTCAGAGCTGTGTAGTTTGCCGC ATTCTTTGGAAGATG[G/A]TCGATATCTCTCTCC ACCACCATTTTTCCCCTCTCTCTCCCTTTGGACTT
solcap_snp_c1_14246 PGSC0003DMB000000200 340613 TGCCTACATTACTAATAATTGGGCATATTTGATCA AATCAATTGAAGGCA[G/A]GGAAATCCCTTCCAT ACATGCAAAAGACTGCTTGTTTGAGCTGTCTTTGC
solcap_snp_c1_14248 PGSC0003DMB000000200 340513 CAAACCAAATTTCATGAATGGCTATTGGAAAGAGT TATTGAAGGGTCTAA[G/A]ACCTCAGAGCGAGAT GAGCAAGGTCAAGGAGTTATCCATTTGTGTGCTAT
solcap_snp_c1_14249 PGSC0003DMB000000200 340501 CATGAATGGCTATTGGAAAGAGTTATTGAAGGGTC TAAGACCTCAGAGCG[A/G]GATGAGCAAGGTCAA GGAGTTATCCATTTGTGTGCTATCCTAGGTTATAC
solcap_snp_c1_14259 PGSC0003DMB000000200 336143 TATGGTATATCAATCTTGTTTCCCAAAATGAGAAA TGGGACATTTGTTAA[C/T]GACTCATCTGACAGA AGCCCATCCAATTCCTTCTTTGCCTCTGGAAACCT
solcap_snp_c1_14261 PGSC0003DMB000000200 334701 TTGCCAGCATTATCAAGCCCTAAAAACAAGATCTT CGCATCCTTCTGCCA[C/T]AACCCTAGTGATGCC AACACTCCATAGAACCAATCCACCAGAAACATGAT
solcap_snp_c1_14271 PGSC0003DMB000000847 40187 ATTCTGCAAACTAAATTAGAGAGTGTCCCAGCATC CAAGATATATGCAGC[G/A]GAGTCCCTTCGAGCA GGATATGCAATATTTGCCTCTGGAATTATTGTGGG
solcap_snp_c1_14280 PGSC0003DMB000000141 684747 TGAAGCTGTGAAGTTTGGTGTGGTGAGTGAAGAGG GTGAGTTGTTGAGAG[A/C]TAATGCAAGACAAAT GAGTGGTTTGTTTGGAGATAGGAAGAGAAATGAAG
solcap_snp_c1_14281 PGSC0003DMB000000141 684766 GTGGTGAGTGAAGAGGGTGAGTTGTTGAGAGATAA TGCAAGACAAATGAG[T/C]GGTTTGTTTGGAGAT AGGAAGAGAAATGAAGAACTTATTGATGATTGTGT
solcap_snp_c1_14293 PGSC0003DMB000000141 657275 GAAATATGCAGATTTTTTTCTCAATTGAAAGGATC CCTAAGTGGTGTCTC[T/C]CTATGTGCAGACCAC AAAACACTCTACTGCTGGCTGTATGATGTTGATTG
solcap_snp_c1_14314 PGSC0003DMB000000232 186894 TAGTGAGAAACATCTTCGATCTGATTCGTCACAGC TTTGAGAATCCGCGA[T/A]AGCTAAGAACTGACT GAGAATCGATTTGTTCTACTTGTTTTTAACTTGAG
solcap_snp_c1_14315 PGSC0003DMB000000605 104980 GCTCAATTGAACCTGGTTGAAGATTGACTTGCTTA ACAATAGGATCACCC[G/A]CTCTTAAGCTTTCAA TTTCTTCAACTGGCCACTGAAGTAGATGTGTCCCT
solcap_snp_c1_14316 PGSC0003DMB000000605 141366 GGTGATAAAGTCCCATCATAGTCCAGAAAAAGTGC TATTCTTTTGCCTTT[T/G]GCATAATTTGTGATT TGCTCAAATGATGAAAGTGCCGACGGATACTTGAG
solcap_snp_c1_14330 PGSC0003DMB000000085 440669 TCAAATAAAGCTATGCTCTTGCAAATAGGAGTTGC AATGAAAGCTATGCC[A/G]TGGTACTGTGCCCTT CCATCACTTTCTGAGTACATGATTGAAAATGGGTG
solcap_snp_c1_14332 PGSC0003DMB000000085 439494 GCCGGTTACCATACCATCCACCATACTACGTACCG CCATAATTATGGTCA[C/T]TACACAATATGGATG GACTGGATGTTTGGAACTCTTCGCGATCCTGTTGA
solcap_snp_c1_14362 PGSC0003DMB000000278 790511 TCTGATCGAATATGAGGCAATGGCGATGATGAATT TGCCTATACGAATAC[G/A]GACTGCTGACGGTGA GCTTGTGAAGAGACGTCGGTGGCTTTGATTCCTCT
solcap_snp_c1_14370 PGSC0003DMB000000409 517655 CAGTCTTGAAAGCATTGTAAAATCGAGCATTTGCT GCTAGTACAGATGCA[T/C]TACTATTCTCCTGGA GAAGCCGGAGGCTATCCCTGATTTTTGCTGCTTGG
solcap_snp_c1_14371 PGSC0003DMB000000409 517673 GCATAGCAGCTAAATCTCCAGTCTTGAAAGCATTG TAAAATCGAGCATTT[G/A]CTGCTAGTACAGATG CATTACTATTCTCCTGGAGAAGCCGGAGGCTATCC
solcap_snp_c1_14388 PGSC0003DMB000000409 351276 GAATGAATCATCAAGCAGAGGATTACTAATTTACA TTAAACATGGATTGG[T/C]TCAGCAATCATTAGA AGATGGAATCAACAAAGATATTTTTCAATATTCCC
solcap_snp_c1_14392 PGSC0003DMB000000409 440433 GGCATTTATGGTTATCCTAGAGACCAAAAGAGCAA GAATGGAAAGTTGAG[G/A]CTTTTGTACGAGTGT GCTCCCATGAGCTTCATTGTGGAACAAGCTGGTGG
solcap_snp_c1_14393 PGSC0003DMB000000409 440682 TTGGGAAATGGCGTTTTTTCCTTTAACTTGGATCC GATGTACGGAGAATT[T/C]GTTCTGACTCAAGAA AATGTCCAAATACCAAAGTCTGGAAAGATCTATTC
solcap_snp_c1_14394 PGSC0003DMB000000409 440691 GTACTCACCTTGGGAAATGGCGTTTTTTCCTTTAA CTTGGATCCGATGTA[C/T]GGAGAATTTGTTCTG ACTCAAGAAAATGTCCAAATACCAAAGTCTGGAAA
solcap_snp_c1_14396 PGSC0003DMB000000078 1700350 CTTCTCCTCCAATCCAGTCACCCTAATCCCATTTT CCTCTAAACCCATCT[T/C]CCCCCTTTTCGTCTA TATTCTTCAACAATCTCCCAGATTCTTCTGGGACT
solcap_snp_c1_14397 PGSC0003DMB000000181 281090 GGGGTTGAGGCATTTTTCCGGTCAAGTGGCGGCGC CGACGGAATTGCCGC[C/G]GTTTGACTACCAACC AAAGCCGTATAAAGGACCTTTGGCTGATGAAGTGT
solcap_snp_c1_14398 PGSC0003DMB000000181 281092 GAGGGGTTGAGGCATTTTTCCGGTCAAGTGGCGGC GCCGACGGAATTGCC[G/C]CCGTTTGACTACCAA CCAAAGCCGTATAAAGGACCTTTGGCTGATGAAGT
solcap_snp_c1_14400 PGSC0003DMB000000178 493295 TTGGAACTGCTGAGAGCGGGCTGAACTCGGTTGTG TTGGCAAACAATGAC[G/C]AGACAGTGTTGCTTC CGATGAATGAGCCGGTATATGGAACTAAAAGGAAG
solcap_snp_c1_14402 PGSC0003DMB000000178 493506 ACGCCTGGATTTGTTCGTCACTGAGTACATCCCCA GCCCTACTTTTCAAA[T/G]TCTTATAATAAGTAG GCGGAGGTGAAGGCATGAATTCAAATCCCCCAACT
solcap_snp_c1_14403 PGSC0003DMB000000178 495863 GAAATTTCAATTAGATTGCAAGCTAATGCTTGTAT ATATTCAAGCAGCAG[C/T]TACTTGATTAACATG TTTGGCTTCAAGCATCTTCTCGTATTCCTCGATTG
solcap_snp_c1_14404 PGSC0003DMB000000178 495897 TAGAGACATCAAATGTAAGCTTAGATGCCCCGGTG AAATTTCAATTAGAT[T/G]GCAAGCTAATGCTTG TATATATTCAAGCAGCAGCTACTTGATTAACATGT
solcap_snp_c1_14419 PGSC0003DMB000000083 286891 TTCCTAACGGGCTCAGTACGGCCCGAATTAGCACC AACCTTGGCCGTTTC[A/G]GAGGACCCAGTAAGC ATTTGAACTACCTGTTTGAAAGAGGAAGCGTCAGC
solcap_snp_c1_14423 PGSC0003DMB000000083 171005 TCATAGCTTCCGGCAACCATGCTTCGATTCTCCAA ATTCTTGCCACAATT[C/T]TGATTCTTTAAGCTC ACAGCAGGGGCAGACTTAGCAGACCCCCAAAATTC
solcap_snp_c1_14442 PGSC0003DMB000000123 1564946 TTGATAGAAAAAAAAGGAAGAAAAATGTGTGTGAT TTTGGAAAAAGAGGG[C/T]GATGATGATGGTGTG CTGTTGGTTTCACCGAATAATTTTTCTGCTGTTGA
solcap_snp_c1_14476 PGSC0003DMB000000129 744127 ATGAATCTCCTGCTCTACATGTCACCAATTGCTGT TGTAGTATTATTGCC[T/G]GCTGCACTCGTTATG GAGCCTAATGTTATCGAAGTCACTGCAACAATCGC
solcap_snp_c1_14503 PGSC0003DMB000000534 298328 TCCTCGCCGGAGTTTGAACCTTCGATTATTGTAGC TCATCGGAAGATCAG[T/C]GGTGCGGTGAAGATC TGGTGGTGTTGAGCTGCTGGCAGCAGCGATGGTTA
solcap_snp_c1_14512 PGSC0003DMB000000534 241386 AACTGGGAATGGGCAGCTGGATTTTCGTCGAGATT TGGTCTTTATTACGT[A/G]GATTACAAAGACAAC CTCAAGAGATATCCCAAAGATTCCGTGAACTGGTT
solcap_snp_c1_14531 PGSC0003DMB000000278 46018 CATTTCTAGCTTTACCGAGAATTTCGCAACATGAT AATTAAAACATAGCT[A/G]AACCAAAAGAAGTAT ACCACAGATAACAAAGTCTCAATGTCAAAATCTCA
solcap_snp_c1_14538 PGSC0003DMB000000675 92224 AGCTGCACTCAGATTGACAGGGTACGAGTTGCCAT TCTCATACTTCCCAC[G/A]GACGAAGCAAGTGGC AGAGTAAAGGGAGGTTGCTGCGCCCATGCTAAAGC
solcap_snp_c1_14542 PGSC0003DMB000000135 8297 AAAGTACGCCACAACTGTTCTTTGAAATGACCCCC TTCAACAGCCACCAT[A/G]TGTATAGGAGCATTA GGAGTACCAAGAGCACCATCCTTTGTAGCTTTGCC
solcap_snp_c1_14569 PGSC0003DMB000000019 1614073 ATGGTAGTTTTTCAATATGGCTCGATTGTCTTGTT TAATGTTTCCGATCA[C/T]GAGGTTGATGGATAC CTGAAGATTGTCGAGAGACATGCTTCAGGGTTATT
solcap_snp_c1_14577 PGSC0003DMB000000151 141824 AAGAACATGGACAATAATTGGAGTCAACGGAGTTT ATCAGCGGAAGATTC[T/C]TGTGGAGCTTTCCAT TTATGATAAACCTAATAGGCAAACTTGTATTTACA
solcap_snp_c1_14582 PGSC0003DMB000000114 1312320 AGAAATGGTGATGTACCATTTACACATGCTAATAT TACATTGGCTAAAAA[G/T]GATTTTGGGTATAAG CCAACCACAGATTTGTCAAGTGGATTAAGGAAATT
solcap_snp_c1_14588 PGSC0003DMB000000173 915085 TTTCTGAAGAAATCCACTGTCAAGTAAGAAGATTC CATGTCCACTAATCT[G/A]ACTACCGTCTTTCTA CCTTCATCCCGGAATTTTTCCAAGGCTTCATTAGA
solcap_snp_c1_14613 PGSC0003DMB000000150 1220345 GAATTACAAAGTGCGTCTTTAGTAGGAGGGTTTCC AGCATTAATGACATA[C/A]GTAGAAGCAATTATC TTGCTATTTGATCGGCTGCTCATCAATTCAGCAAC
solcap_snp_c1_14614 PGSC0003DMB000000150 1220308 GATGATATCTGCTCCTGTGGACTGCAGGTTTATGA TGGAATTACAAAGTG[C/T]GTCTTTAGTAGGAGG GTTTCCAGCATTAATGACATACGTAGAAGCAATTA
solcap_snp_c1_14629 PGSC0003DMB000000035 1498428 ACTTATTGGTATGTGGATGCTTTTGAGGTGCGTTT GTTCATTCCAAGATT[T/G]ATTACAATTACTGTA ATATCATCATGATATTTTCTTCTTCTACCAGCTGG
solcap_snp_c1_14633 PGSC0003DMB000000035 1586775 TTCAGGAAATTGTTAGCAATGCATCAATCATTCCA ACAAACTCCATAGTC[C/T]ACTCTGTTGCTCACA CGGGATATTTGAAATTGCAGCAAAGAGCATGTTCA
solcap_snp_c1_14641 PGSC0003DMB000000248 680552 GAAGTTCGAAAATATGGAACAACTATTGCACCTGG CTTGTATGCACCTGT[A/G]CATCAGCACTTCTTT GTGGCTCGCATGGATATGGCTGTTGATTGCAAATC
solcap_snp_c1_14643 PGSC0003DMB000000248 679640 CCATAGGGCACAACCATTTCAATGAAGCTCAGTCT ATGAGCAACAGGTCT[A/G]CGGCCTCTGCTACCA TCAATATATGCAACAGAATAGATAACCAGGCCCTC
solcap_snp_c1_14644 PGSC0003DMB000000248 679391 AAGCTAGGACCTTCAGGTTGAACAATAAGAAGAGG TTTAACATCACTTCG[G/A]TCAACCCCTCCTCTC GTTTCACCGGCAGTGTAATTTCTCAATGGATCAGC
solcap_snp_c1_14645 PGSC0003DMB000000248 761964 CCAGAAGTCATCCCAAGAAACTGTTTAGCCCTTGC AATTGCATCAGCAGG[G/A]AATATGAGTCCCACA TTCGGATCATCCAGTAAAAATGGAGCTTGACAGAG
solcap_snp_c1_14647 PGSC0003DMB000000667 170243 AGGTACCGTAATATCATGGACATGAATTCTGGACT TGGAGGTTTTGCTGC[T/A]GCTCTTCAATCTCCC AAGTTGTGGGTTATGAATGTTATGCCTACGATAGC
solcap_snp_c1_14648 PGSC0003DMB000000667 170316 AATTCATGTCCATGATATTACGGTACCTTCCTGTG TCGATGAGTTTGTTA[C/A]TTTTCTTATAAGCAC TAACATGCTTCTTCCATTTCTTGCTGTCTTCCAGA
solcap_snp_c1_14649 PGSC0003DMB000000667 170355 TGAGTTTGTTACTTTTCTTATAAGCACTAACATGC TTCTTCCATTTCTTG[C/T]TGTCTTCCAGATATG CCTCAACGGAGACTCCAGAAACTAGTCCATTAGCA
solcap_snp_c1_14650 PGSC0003DMB000000667 182345 CTTGACAAATACGGCACTCTGCACCCCCAATTAAC GGCACCTCCTCATTC[C/T]CTTCTTCTTCTTCCT CAACAGCCAATTCCTTTTCCTTCATCGTCTTCGAA
solcap_snp_c1_14654 PGSC0003DMB000000667 202055 GATTCAGGATCCTCCGCGTCATACTGATGCAACGA CACGTTCTCTTCTTT[G/A]GCACGGACTTGTTCC AACGACTTCAGCTCCGCGTACAGCTTCTCAGCTAC
solcap_snp_c1_14663 PGSC0003DMB000000231 413005 TGAGAAAAGTTGAATCTGGCAACATTCATGCCAGC CCGGAGAAGCTTCTC[G/C]ACCATGGGAACTGAG CGAGATGCTGGGCCTAAAGTGCATACAATCTTGGT
solcap_snp_c1_14664 PGSC0003DMB000000231 412932 TTCTTCCCTTCTCTCCTTCCTTTTCCTTTTGGCTA TGGCGATTGAAAACA[G/A]CAACAATGTCAAGAG GCCTAAGACCAAGATTGTATGCACTTTAGGCCCAG
solcap_snp_c1_14668 PGSC0003DMB000000293 205216 CAGGTTGCTGTTTCTTTCAGCTGTTCATCATCGGA TTGAAGACACTCACC[C/T]AACAGCTGTTCGAGA AATGCAGGATCTTTGAATATGGTCTTTGCACTGGA
solcap_snp_c1_14669 PGSC0003DMB000000293 303777 ACACACTTCAAGCTTATAAGTTGCATAGAACAATT GCATCTGCAAAATAA[A/G]CACTCATCGTGGCAA TCTTGTTTTGCTTCAACTGGTTTGAACCAAAATCC
solcap_snp_c1_14674 PGSC0003DMB000000293 267042 CATTGCTTAACATGGGCCCGGTCAGAATTTGAGGG TTTGCTTGAGAAGAC[A/G]CCAACTGAAGTTAAT GCTTATCTGATCAATCCTAGCGATTACATATCTTC
solcap_snp_c1_14676 PGSC0003DMB000000293 266931 GCTGGTGATGCACAGGCCAGGGACATTTTGGATCG TGTTCTTGAATGCCT[C/T]GACAAGGAGAGATGT GATACATTTGAAGACTGCATAACCTGGGCTCGCCT
solcap_snp_c1_14683 PGSC0003DMB000000367 466916 CCGAATGAAGTCACGTCTATTTTGCGGATGAGGGG TTTGCCATTTTCTGC[C/T]GGCAAGGATGACATC ATGGATTTCTTCAAAGATTTTGCGTTGACTGAGGA
solcap_snp_c1_14684 PGSC0003DMB000000619 207967 CAGCATTTCCAGGCATGTGGTACTGTGAATCGAGT TACCATCCTGACTGA[T/C]AAGTTTGGTCAACCT AAAGGTTTTGCGTATGTGGAATTCGTGGAACAAGA
solcap_snp_c1_14700 PGSC0003DMB000000042 243636 GATCCGAGATGGGATAAGATTAAGAGCAGGTTCAG TCGGATTAAGGTAAG[A/G]CCGGGGTCTGATAGG CCAGAGGTTAGAAGGTGGAACAATCAAGATAGTTG
solcap_snp_c1_14724 PGSC0003DMB000000164 138773 GCACTATTGAGGGCCACCATAAAAGGTCTTGTCTA CCCTGAGCACTATTT[C/T]GTGGAGGTTCTTCGT GATGCAATTAACAGGAGAGGAACAGAGGAAGATCA
solcap_snp_c1_14735 PGSC0003DMB000000358 171332 ATACTGTCATCTAAAACCCTAGCCGGAAACTTATC TGAGATGGGCGATTT[C/T]TCCACCGCCGGCAAC GGTGACAATCTCCCGCCGGCCTCTCCCAAACTTCC
solcap_snp_c1_14759 PGSC0003DMB000000562 301555 TTGTTTTTCAAGGCAAGAGCGTGTACAGCATCATC ATCCGCGACTTCTCC[G/A]AATTTGCCAAGTCCA AGTTCAGCAGCATGTATTCCGCCTGTGATTAACGC
solcap_snp_c1_14763 PGSC0003DMB000000535 261342 TGCAGATGGAAACTCAAATCATTAATTTTCTTCAC ATCTCTAGCTTTAAG[A/C]CTTCAATCCGAGCTT GAATCGTAGAAGTCACTGGGACATGGAGTCATGAC
solcap_snp_c1_14767 PGSC0003DMB000000014 2917924 ATTGGATAACCTACTACTGTCACAGCATCTTGAAG CGTTGGCAAATCCCC[G/A]AATTCCACAGGTGAG ACCCCCTCCCAGAACTCATCATCATCCACAGTAAG
solcap_snp_c1_14770 PGSC0003DMB000000529 260228 GCAACTCCAGCAAAGTGAAAGGTTTTCAGTGTCAT CTGTGTCCCAGGTTC[T/C]CCAATACTCTGAGCT CCAATTGCACCAATCGCAGTTCCAGCTTCTAGTCT
solcap_snp_c1_14778 PGSC0003DMB000000614 30421 GAACACCACCATAATTAACAAAAAAAAATAAAGAA GAAAGGTATATAAAA[G/A]TGTCTGCACATTGAA GGCTGCCTTACATTAAAGTTGCAAAGGACTACTAC
solcap_snp_c1_14783 PGSC0003DMB000000702 129067 TTCACTGGCCAAATTGTCTAGCTGTTGCTAGAGCA TTGAGCATTGCATTC[G/A]GTGGAAATTTTGTGT ACACAGTAAAGAAATTTTGAGTACTTTAGGTCTTA
solcap_snp_c1_14797 PGSC0003DMB000000609 99473 GACGAAAAAGGTGAAACCAGTCTGTAAAGTAATAT TGTTTTCACGTTCTG[T/C]ATAGTGAAAAAAACT TTCCTGGAAATTTGGAAGATGAACACCCCTACGGA
solcap_snp_c1_14797 PGSC0003DMB000000609 132748 GACGAAAAAGGTGAAACCAGTCTGTAAAGTAATAT TGTTTTCACGTTCTG[T/C]ATAGTGAAAAAAACT TTCCTGGAAATTTGGAAGATGAACACCCCTACGGA
solcap_snp_c1_14800 PGSC0003DMB000000609 152086 GCGGTACCTTCCAGTGTCCAGGAGTTTGTTGATCT TCTTATAAGCACTTA[C/T]GTGTTTCTTCCATTT CTTGCTGTCTTCTTGATATTTCGCAACAGACACTC
solcap_snp_c1_14801 PGSC0003DMB000000609 151992 GACACTCCAGAAACTAATCCATTGGCAATTCTTGG AGGAACAGCATAAAG[T/C]CTCTCAGGGAATGGC TTTAGACTCTCGTCTCCACCATTACCATTGTTTGG
solcap_snp_c1_14802 PGSC0003DMB000000609 149920 AGATTCCCAGGAGGAGGGACACAATTCCCTCAAGG AGCAGATAAGTATAT[T/A]GATCAGCTTGCTTCA GTTGTCCCAATCGAAAATGGGACAGTTCGGACTGC
solcap_snp_c1_14813 PGSC0003DMB000000039 882497 ACGTCAAAGATTGGTGAGGATCAGTTATTTTATTT CCAGCAGAGGGGAAT[T/C]GACTACGAGAAAGCA ATGGCTGCAATGATATCGGGTTTCTGCAGGGACGT
solcap_snp_c1_14823 PGSC0003DMB000000590 172148 CCTAACACGCAAGTGGGATTGGGATACCCTACAAT CTTCAACTGAAATTT[T/C]CCGGCGCCGGTAGTT CTCACATCGGAGAAAATGGCGGAAACAGAGGAAGA
solcap_snp_c1_14836 PGSC0003DMB000000424 388507 CACTGACAAGTTCTGTGCCGGGGTTGAAGTGGCTA GATCCGTGGATCAGA[G/T]GTATCACATATCAGA TACCACCAGATCAGCTGTTTCAGCTACAGGTAGAA
solcap_snp_c1_14839 PGSC0003DMB000000424 397394 TTTCTGACTCTCTGCACGTTAGTAACTCTCTACTT CGCCAATGAAGTCCC[G/T]CTGTCACCCAAGCAA TATAAACGCTTGTCAGATTCTGCTCCTCTCTTGGA
solcap_snp_c1_14840 PGSC0003DMB000000424 397412 TTAGTAACTCTCTACTTCGCCAATGAAGTCCCGCT GTCACCCAAGCAATA[T/C]AAACGCTTGTCAGAT TCTGCTCCTCTCTTGGATAGTCCTCAGAATACTGG
solcap_snp_c1_14841 PGSC0003DMB000000424 398310 TGCACCGCTATCATTAGCGTGGTTTCTATCAGTGC ACATACGGAGGGAGT[C/T]CAACATGTGATTGGT GCTACTCGATCAACTCAAATTGCTGCTTTGGTTGT
solcap_snp_c1_14869 PGSC0003DMB000000297 414065 TCCGTTATCTTCAATTGATTTACCATCCTTGCAGG ACATTGACATTATGA[T/C]TCCTTACAATCTAAA CACCCCTTTTGTTTACACAGCTTTCCCAAGTCTTC
solcap_snp_c1_14870 PGSC0003DMB000000297 414053 AATTGATTTACCATCCTTGCAGGACATTGACATTA TGATTCCTTACAATC[T/C]AAACACCCCTTTTGT TTACACAGCTTTCCCAAGTCTTCAACAACAATTCA
solcap_snp_c1_14880 PGSC0003DMB000000401 528881 TTGGAAGACTTGACATACCTGCATCTCAAACTACA TATCTCACCCTAACA[C/T]AAATTCTACAAGATG GTATTGAAAAAGTTATCCTTCGCTCAAGCATATTC
solcap_snp_c1_14884 PGSC0003DMB000000240 47566 ATGCACTGTCCAGAAAAACATTATTGCAGAAGCCT CTTGTTTTACGTCTA[T/C]GTCAGTGCTACTGTT TTTTGTTCATGTCATACAGCACACAAGCATCAGCC
solcap_snp_c1_14900 PGSC0003DMB000000001 672040 ACAAAATGTCGGACACTGATGCTTGTTCCAACTGG AAGAAGTGCATCTTC[G/A]GTAACAGGAAACTCC TTCAACTTTCTCTTCATGGGCACACCTTGTGCTCT
solcap_snp_c1_14913 PGSC0003DMB000000069 1024115 GTGATAGAACGAAGAACACAAGCGGTGATCTTTAG CGTCCTGTCCAAATC[G/A]AGGCACTTTTTGTCG TTATCAATGACAGGAATGTAGAAGAACAACGGATC
solcap_snp_c1_14928 PGSC0003DMB000000477 337413 CTAATTTGTTGAAATATAGCAAATTGCTGGTTGTT ATAAGTCACAAAAAT[C/A]ATCAATTATGACTAC AAATGTATGTTCCACATTAGCTTGTTAGCTACTAC
solcap_snp_c1_14929 PGSC0003DMB000000477 337550 TGAAAGGGCGCCAATATTCCTCGGTAGTTACGATG ATGTGGAGGAGATCA[A/G]AAGGCTTTATGCTGC TGAAGAGAAAAACTAATGGATGTACATTTACATTC
solcap_snp_c1_14931 PGSC0003DMB000000092 861681 CTGAATGCTGTTAGTGCTTACTGCTCAACTTGGGA TGCTAATAAGCCTTT[A/G]TCCTGGCGGAAGAAA TATGGTTGGACTGCTTTCTGTGGTCCAGTCGGACC
solcap_snp_c1_14947 PGSC0003DMB000000141 22257 TTGAAGCGAATGATCTTATCCATGATGGGAATGCC AAAAGCTAGTGTCTT[C/T]CCAGTTCCAGTTCTA GCTCGACCTATCATGTCAGATCCTTGCATTGCTGG
solcap_snp_c1_14951 PGSC0003DMB000000291 169164 GACTCTGTGATCTCCCCATAGCTGGCATGCTCCTT TGCAACAGATACCAA[T/G]GCAGCACTAATGCGT GATTTCAATCCTGGAAGAACTGTCTTGATGTGTTG
solcap_snp_c1_14954 PGSC0003DMB000000216 118782 GTCAAAAGGCTGTTCTTCAACAACAAACACAGAGC TGCAGATTTTTACAA[C/T]GAAGTCAATATTATT AGCAGTGTTGAGCACAAAAATTTAGTAAGGTTATT
solcap_snp_c1_14956 PGSC0003DMB000000001 3686613 CACATAATTGGTGCTTTTATTCCAGCAACAATGGT AGCGGTCCTGTATTA[C/T]TTTGATCACAGCGTG GCATCTCAACTTGCTCAGCAAAAAGAGTTTAACCT
solcap_snp_c1_14959 PGSC0003DMB000000364 379253 AACTGAGGTCTCGTTGCCCCCAATGTGTTTGGTTC ATCATCAGTGCAACA[T/C]GAGTGCATTCCACAA GCTATTCTGGGAATGGATGTCATTTGCCAAGCTAA
solcap_snp_c1_14969 PGSC0003DMB000000071 148761 CTCATGGTATAATCAGTGCCATTGACACCCGGCAT TGCAAATATTACCCC[A/G]TCCGCACCAATACCG AAGTTTCTATCACACAGTTTCACAGCTTGATCAGG
solcap_snp_c1_14973 PGSC0003DMB000000374 241354 TGGCTACTACTGGCGGTGACACTGTTAAGCTTTTT GACCTCACTTTGGAG[C/T]CCCGTGATCCCTGCA TTCTTAGTTATACTCCTTCCCCTGGATTCCAAGTC
solcap_snp_c1_14975 PGSC0003DMB000000374 230210 GATACCAAACTCCAAAGATGGCCCATTCTTCTTAG ACACCCTAACAACTA[G/A]AGGAATTTGGGACTG ATTGGCCCCTTCGTTATCAGGGTGGTCACGATCGT
solcap_snp_c1_14992 PGSC0003DMB000000736 32192 TTTGTATCGTTGACAGAGCAGTGCTCCTGAAAGGC TTTTCTTCTTGATTG[C/T]TCTCATGCTTCACTT ACAACTATCCCAACCTAAATATTACCTAAAATTGT
solcap_snp_c1_15006 PGSC0003DMB000000892 3054 AACTTGAGAAGAAATTTGGCCAATCACCGGTATTT GTTGCTTCAACACTT[C/T]TAGAAGATGGTGGCA TTCCTCCAGGAGCAACATCAGCATCTCTCTTGAAA
solcap_snp_c1_15012 PGSC0003DMB000000892 44904 CAAAACTTCAGTGCAGAAAATGTGGTAACAATATT GGAATTGCTTATGAT[A/G]ATAGTGCTTCTTCTT ACCCACTTGTAGCCGATGCATCAGATACAGCCTCT
solcap_snp_c1_15031 PGSC0003DMB000000144 505945 TTGAAAAAGTTGTGTTCACTTCCTCAGCAACTGCA ATTATTTGGGGACAT[C/T]ATGAAAATGATCAAA ACTCTGCATCCATGCTTCTTGATGAAAGACATTGG
solcap_snp_c1_15033 PGSC0003DMB000000038 864083 AAACCAGTGCCAAATGATGAAGTTGACGGCGTGCC GAATGCTGGGGTTGA[T/C]GAAGGTGTGCCGAAT GCTGGGGTTGACGAAGGTGTGCCGAATGATGGAGT
solcap_snp_c1_15034 PGSC0003DMB000000038 864209 CTCAAGGGTGTGGAAAAGCTGAAAGGGGACAAACT CTGAGGTGTTTGAAA[G/T]AAGGAAGTTTGTTGC TGTTGATGTGGCTGTGGCTGTGCCTGCTGTGAAAA
solcap_snp_c1_15041 PGSC0003DMB000000298 468465 TCAGAAATCAAGAGTCAGTTAAATTTGGCTGATGA TGACTTGGTCAGATT[G/T]CTTCAATCCCTTTCA TGTGCCAAGTATAAAATTCTGATCAAGGAGCCTAG
solcap_snp_c1_15041 PGSC0003DMB000000021 1366017 TCAGAAATCAAGAGTCAGTTAAATTTGGCTGATGA TGACTTGGTCAGATT[G/T]CTTCAATCCCTTTCA TGTGCCAAGTATAAAATTCTGATCAAGGAGCCTAG
solcap_snp_c1_15042 PGSC0003DMB000000006 3085410 CACAGAACACACTCAAGAGCTTTTCTCACAAAGAT GAAGAGTTGAAGATC[A/G]AACACAGAGTTGAAG AGCTGAAGAAATGAAGAGTTGAAGATCGAACACAG
solcap_snp_c1_15043 PGSC0003DMB000000487 332792 TCAAAGCTTGGTGTTGAAGTGACTGTCGCTGATGC AAGATTCTGCAAGCC[C/T]CTTGACATACAACTT CTTAGGCAATTATGCAAGAACCATTCCTTTCTAGT
solcap_snp_c1_15044 PGSC0003DMB000000487 332855 GATGTTGCTTTACTTGGCTATGGATCCATGGTACA AAATTGTCTGAGAGC[C/T]CAATCACTTCTTTCA AAGCTTGGTGTTGAAGTGACTGTCGCTGATGCAAG
solcap_snp_c1_15045 PGSC0003DMB000000487 342680 TAATGAAATTCGATCAGAATTAGCTTTTATCATCG CAAAATCTCAAAAAC[G/C]TTCAAGTTCCAGTCT GACTGTTGTGGAGCTGACTGTTGCTATTCACCATG
solcap_snp_c1_15046 PGSC0003DMB000000487 251841 AGAACGTGAGGCTTTGGGAGCATTGCCTCTTTATC AGCGTACACTCCCTT[A/G]AAGAAATCCCATCTC CCTTTAAACTTTTTCCATTGAGAATAACTACTGTA
solcap_snp_c1_15048 PGSC0003DMB000000487 283046 GGCAAGGTATATTGCCGTTGTGATGTTGGATAGAA AGACGATGGCATAGC[T/C]ATAAAAGTCAAATGA CAGGTCCCGAGCTCCAGCAACAAAAGCACCGAACA
solcap_snp_c1_15061 PGSC0003DMB000000150 1089559 GCATACAGGAGGTCAATATCGACATTGGTTGATTG GATAGGTCATGAAGT[G/A]AATATGACCAAGACA CATGTCGTATTTCGAACTTATGCTCCTGTTCACTT
solcap_snp_c1_15062 PGSC0003DMB000000150 1090917 TTGACTTTGAGACTGGATCAAATGGATTGGAGCTC TGCTCAATGGAAAGG[G/A]GCAGATGTTTTGGTA TTCAACAGTGGTCACTGGTGGATTTATGAAAAAAC
solcap_snp_c1_15063 PGSC0003DMB000000150 1091052 GGAAATCCCATCACAAAGCACATGGGTTTCTTGAT TTTTAAGTTCAAGGA[T/G]TTCAACTGCACTATT GAGTACTATAGAGCTCCATTCCTAGTGTTTCAAGG
solcap_snp_c1_15081 PGSC0003DMB000000819 74945 AATGTGTTGCCTGTTCGCACAGCAAAGCACATTGC ACTCAACATCAACTT[G/A]TGTTTGTGTAGCATG GGCTCCAAAATCCGTTGTTCAATTACACCAGCTAC
solcap_snp_c1_15085 PGSC0003DMB000000480 265931 GGAGGGTCAGAAGTGCAATCATACCAGCTGTCTTC AGGTTCTTGATGGGT[C/T]AAAAAGGGTCGGGCA TCAATACCAAGATCCGATGCCAGCACCAACACTGA
solcap_snp_c1_15098 PGSC0003DMB000000009 230537 TGCCACATGGTTGAGCCTAGGATGAAAACACTTGC GGAAAAAGTTGAATG[T/C]CCTGAAAGCCTTGTA CCCATGAGGAAGGCATTTAAAGGTACTTTTTTGGT
solcap_snp_c1_15106 PGSC0003DMB000000690 24943 TGCAAAGGGCCATGATAGTTCTTCTTTTAGTCAGC ATTCCCTTAGCCTTT[A/G]TTTGGGCAAATGCAG GACATATTCTTGAAATCTTGGGACAAAGTCCGGAA
solcap_snp_c1_15123 PGSC0003DMB000000136 448347 GAATAAAAATGAAATCCTTTCCAAAAAGATTGACT TTTGTGGTCCATCTA[C/T]GAACTCGCAGGAAAG CAGCTCTACCTTCACAAGCTTTAGAAGGATCTCTA
solcap_snp_c1_15140 PGSC0003DMB000000140 77740 TTCTTTCACTCCGGTTGTTTGCAAAGATGGATGGA CATAAAGATGGAGTG[T/C]CCAACATGCCGACGT CCTCTTCCACCAGCTTGAATAAATGTTATTTCTTG
solcap_snp_c1_15145 PGSC0003DMB000000336 50880 TTATCGACCAATATAGGTTGATTTAGAGGTTCACT GTCAATACGGCCGCT[C/A]GTCTCCTTTACAAAT ATTCTCATGTAAATTGTTGCAACCATTGAAGAAAT
solcap_snp_c1_15175 PGSC0003DMB000000476 47518 CTCATTTGCAGGTACTTTTAGGAGGCAGTGGATAT CGATCAAGCACTGCA[A/G]CATCAACCACTGCAG CGGCAGCCAATGACCCCTTCCTCTCATCTCTAGTT
solcap_snp_c1_15178 PGSC0003DMB000000476 122986 AAGTTCCCTACAAGGTTAACAGCTGACCAGAAGAC TGGAATTAAGAAGTT[A/G]CTTCCTTCCTAGGCC AAACCCATAGCATCTTTACACAAGTCTGTGTACTG
solcap_snp_c1_15189 PGSC0003DMB000000003 1733977 AGGGTTAACGAAGAGCAATTACACAGCAGTGTGAA TGAGGAAGAGAGAGA[A/G]GAATCGTCCGAGGAC TTTGAAGACTCTCGTGCTAGAGCTAAGCGGAGTAA
solcap_snp_c1_15191 PGSC0003DMB000000003 1729279 GTTACATCCTTTATACACATTGCCAAAGTACTTGG TTCACAGCGGGAAAC[C/T]ACACAGAGACAGCTA AATGCTGAACAGAAGAAGAAAGTGGATGGGCCTCG
solcap_snp_c1_15192 PGSC0003DMB000000003 1729195 AAAGTGGATGGGCCTCGAGTTGAATCACTAAATAA AAGATTATCCATGAC[A/C]CATGAAAAGATAACA ATAATAGAGGAGATGATGCGGAAGATATTTACTGG
solcap_snp_c1_15204 PGSC0003DMB000000548 266244 CTTCGCATCTATCTTCTACAGTGGTCGTACCATTG ATTACAGATCCAAAT[T/C]TCTGCTTTTCACATC CCTGCCACCGAGTAACGCTACGCCCTGCAGCAGCA
solcap_snp_c1_15213 PGSC0003DMB000000406 388342 ACCATTTTCAACCCAACCCGTCTTGCAAATGGAGA AGGCGCAACATTGGG[G/A]ACAGTCATATTTGAT ATTGAATTGGTCAGCCTGAGGCATCTCTGATCTCG
solcap_snp_c1_15218 PGSC0003DMB000000436 268565 CTCCATAGTTAGAAAGGTAAGACTAGTTATATGTG TTGCGATATATATTT[A/G]CTACTTGCTAGTGCA TCTCATGGTTGTGAAACTTGTTTGCACACTGCTGG
solcap_snp_c1_15219 PGSC0003DMB000000436 174050 CCGGGCAAATGCCTTGGTAATTTCTCCTCCAGCAA TACTGGCACTTCGAA[T/C]GGACATTTGATCATT TTTGAGTTCCTTCTCTGACATGCTTTGGGTTTCCC
solcap_snp_c1_15225 PGSC0003DMB000000436 211523 ACATCTTGGTTCAAGACTATGATTTCAGATTCTGA TTACACCGAATTCGA[G/A]AACTTCACAAAGTGG CTTGGCGTTACACAGTAAATGATCATTTTTGTTTT
solcap_snp_c1_15233 PGSC0003DMB000000315 218451 GGACACATCTTTGTACATGAGAAATCTGCAGCTGG CATCTGGTACGAGCT[A/G]AAACGTCATCATGGA ACTCAAGCTTCTCATCTTCCTTTGATGAAGGATGT
solcap_snp_c1_15235 PGSC0003DMB000000273 196714 TCATAGATGAGTTGTGACTGAGAGTTAAACTGAGC TTTGACAGTTGATAC[C/T]GATCGGTACATGCCA ACATTCTGTGTGTGACCAGTGGTGATAAAATAGAG
solcap_snp_c1_15237 PGSC0003DMB000000784 9605 TCATTGGAGGGCGCTTCGCCGTCTAATGGTAATTG AGATTTTCTCTTTCA[G/A]TAGCCTTCAAAAGTC TTCTGCATTGAGGAGTGAAGAAATTAGAATTCTTA
solcap_snp_c1_15241 PGSC0003DMB000000622 167593 GGGTGATTGGAAATTCTTTATCAGCTGCTGCCGCC CCCAAAGAGATACCC[T/C]AGAGAAGATCCACCA CCAGGGGCCGCATGTACTTTGGTAGATGGCCGGTC
solcap_snp_c1_15249 PGSC0003DMB000000042 919359 TTGTTAGGAATATTCTTTATCATTAGGGTTGTCCT TTTATCGTCCCCTCG[C/T]GCAATCCGTTCAATA TCCAGTTCAAACTGCTTCTTGTTGTCAGTCTGACT
solcap_snp_c1_15259 PGSC0003DMB000000714 140645 GAAGCTGGTTTGGTTCGGGGAGCATAATAATTATA ACAACAAGAAGTGAG[A/C]ATTTGCTAGATGATG TTGGAGTAGACTATAAGTACAAGGTAACAAGGTTG
solcap_snp_c1_15260 PGSC0003DMB000000616 102336 CCGTGTATCCTACTCCTCCATTTTCGCTCTCCCGA ATTTCAACTGATGAC[A/G]CTTCGCCGGTACCTG ACTTCTCCGCCATAGCTTTAATCCTCACCACCGAA
solcap_snp_c1_15292 PGSC0003DMB000000216 777670 TGGGGTTCTGGGTATTTCAAGAAAATGGATTCTGA AACCTTAAAAGATTC[G/A]TATAACGAAGAAATC ATCGAAAAATTAACCGAAGATTTTACAGAGCAGTT
solcap_snp_c1_15298 PGSC0003DMB000000069 1773216 GTGGAGGCATCCCCGGATGAGGTGGCCCACCAGGC ATTCCAGGTCTTGGT[G/A]GCTGCGACCCTGGTG GTGGAGGACCTCTCATCATCTGTGGAGGTGGTGGT
solcap_snp_c1_15312 PGSC0003DMB000000603 11148 TTACCAAAGCAAGAATTTCCACAACATTGGAAGGG AAAGAATGGACTCTA[C/T]TGTGTGGGGCTATCA AGAAGAGGACTTTATGGGATTGCATTTGATGCTCA
solcap_snp_c1_15314 PGSC0003DMB000000275 715037 CTCTTTCAGTTCCTGCTCGAACTTGAGCAATTTTT CCTGAAAAGGCTGCA[A/G]AAATTGCTTCATATC CTGTTTTATTCGATGCTTGTCTTCTTGTCCAAGAT
solcap_snp_c1_15323 PGSC0003DMB000000554 122754 TGTGTCGCCAAGAATGTTGTACTAATGCTGGCTGC CATATTATGTGCCAC[A/G]GTGGTGCGAGGTCTA TTGACGATCCACTTTTTACCAAAGTATTCATCAAT
solcap_snp_c1_15330 PGSC0003DMB000000756 33233 ATCCTCTGCAATGTCTGTTGACGAGATTGTGGAAG AGATGATGAGGCTTA[A/G]CAAATCTCTACCAAT AAGGCCAGGGATAGATGAAGTGGAAGCAGCAAAAG
solcap_snp_c1_15331 PGSC0003DMB000000756 33277 GTGTGTGTGTGTTTTTTTTTTGACGAAATTGAGAG TGAAATGGGATCCTC[T/C]GCAATGTCTGTTGAC GAGATTGTGGAAGAGATGATGAGGCTTAACAAATC
solcap_snp_c1_15333 PGSC0003DMB000000260 855690 AATTGTTCTTATTTTCTACAGAGTTCATAGTCGAT ATTCCTTTATATACC[G/A]TTCAGTAAGGAAGAT TTATGCCATAGCAGCCATGCGAGAGTTTAGGCAGT
solcap_snp_c1_15340 PGSC0003DMB000000173 691722 ATCCATATTGGTCCTGTCGAGTTCCTCTATTACTG GTTTCACAGAGCTCT[G/A]CATCATCATTTTCTC TACTCTCGCTACCATTCCCATCACCACTCCTCCAT
solcap_snp_c1_15342 PGSC0003DMB000000637 224917 GATACACAATTCAACACATTCAAAACATGAGGCTG AGCACATCCAGCTAA[C/T]GTTTAGCATACGCCA TAAGAACGAGTTAAATGGGTTTAATCTTGAAATGG
solcap_snp_c1_15343 PGSC0003DMB000000637 217304 AGTCTGTTGAGAAAGGATGCAACGATCCCATCCGA TGCTATGGTTAAGGC[C/T]GCTCTGTTTGCAGAA GAGAAATAAATGGATTCCCTGTTTGATCTTGTAAG
solcap_snp_c1_15351 PGSC0003DMB000000803 20725 TAAGCATCTGTACTTCAGATTCTGCCAGCTGGGAG TTGAGCTTTAGTCCT[A/G]CTTTAAGTTCTTCGA CTGAAACAATGCCATCATTATTAGTATCTATCTTG
solcap_snp_c1_15353 PGSC0003DMB000000803 18314 AAAATGTCATTTGCCATATTGGTGCAGTCATCTGC TCCATCCTCCATCAA[G/C]GCATCCCGAAGCTCA TCAGGCTCAATGTAACCATTTCCATCCTTGTCAAA
solcap_snp_c1_15357 PGSC0003DMB000000994 26772 CAACCAGCTAATATAACTATACGGGGTGTTGTGTC TTGCTCCACATCGGG[A/G]AATGCCCCAGGCCCC GGAATTGGTGGAGTAAATGTCGCCATTATTTGTGG
solcap_snp_c1_15357 PGSC0003DMB000001544 1252 CAACCAGCTAATATAACTATACGGGGTGTTGTGTC TTGCTCCACATCGGG[A/G]AATGCCCCAGGCCCC GGAATTGGTGGAGTAAATGTCGCCATTATTTGTGG
solcap_snp_c1_15371 PGSC0003DMB000000246 581647 GAACCCAAGATTGAAAGACCGGTAGAACCTGGATG CATTTGTCTATTTCC[T/C]GTAATACCACCTAAA CTTGACTGTGGGCTCCCCAACATATTTGTTCGATT
solcap_snp_c1_15374 PGSC0003DMB000000246 582296 CCAGATGTATACATAGACATGGCAGGGATGATATA GCAACAGCCTACCGT[T/C]TTAAAGGAGCTGAAG CTTACATCTCAATTAGGCATTATTAATGGAATTAC
solcap_snp_c1_15402 PGSC0003DMB000000574 82432 ACGTCATAGGGACGCGTTATCTCTCGCTCATAATC CTTGAGATAGAGCGC[G/A]GGGAAAGGAAATTCC ACCCCTGGTTTAAGAAAAAAATGACCAAAATAACA
solcap_snp_c1_15404 PGSC0003DMB000000574 40659 AGCAAAGGTCGAGGGCCACCTCCCAACATTAGGCG TCCACCTCCTGGACC[C/T]GGCATGATGTATCCT GATTCTTTTGGTCCTCCTATGCACAACCCACCACC
solcap_snp_c1_15416 PGSC0003DMB000000303 189625 CGGCTTGGCGTTGCAGTTACTGAACTTAACCTTGA TTCAGCAAACTCAAT[G/A]TCTATATCAGAAGCA TTGGTACGACGAGAATCACAACAACGTCCATCTGT
solcap_snp_c1_15425 PGSC0003DMB000000363 493628 GGACAGCTCTGCCCCACAGTCCCCAACAGATCAAA CTATATTCATTGGAT[C/T]GAAGATCTTTTGTCA TCGGACATCATTCCTAAAGTTCAAGCTGACAGAGA
solcap_snp_c1_15451 PGSC0003DMB000000132 102622 GAAGACACAAAAGGCAAGATTGACATACTTGTTGC TGGCATTGGAACTGG[C/T]GGAACCATTACAGGA ACAGGCCGATTCCTTAAAGAGCAAAATCCAAACAT
solcap_snp_c1_15452 PGSC0003DMB000000200 607071 ATGTTGTACCTTCAAAATGCTGGTTTTGTTATGTT CTTTAATTTGATGGC[T/G]AAGTAGATATAATAT GTCACTATAAATACATGTGTTGTTTACTAAGTTCT
solcap_snp_c1_15456 PGSC0003DMB000000213 1090719 CGGTAGGAGGAGGAGCATCCCAAGGTGCTGGAGGC AAGTTATCGGCAGAT[T/G]TGGCTTTTGAATTGG ATTCATTGTGGTTGTTTTTTCCAGTAAACATAGAT
solcap_snp_c1_15462 PGSC0003DMB000000047 2196545 CCAGCCAACTGATCACATAATTTGATGCCCTTAGG AAATCAGGCAGAAAT[A/G]TTTAAATTGTGGATT TAGATAGTGCCTCTCAACACCTCTATACATTAGTC
solcap_snp_c1_15466 PGSC0003DMB000000020 2314704 CTCAATTCATCTTTGAACACAATTAAGTGAAACAA AGAAGGCAACACAAA[C/T]CCCAAAACAATGCAC ACACTGCTCCCAACAAGTGACAAGAAATCAGCAAA
solcap_snp_c1_15470 PGSC0003DMB000000071 240906 TTCTCTTCTTGAGAGCTTCTTCCCTTTTCTTTTTG GCATTATCATGTTCT[G/T]CAAGCATCCAAGAAG GCGGACCTCTCTTCTTTTGTATATTGGTCCATTGT
solcap_snp_c1_15481 PGSC0003DMB000000020 2011113 GATGGTCTATTCTTAGAATCCTGTAGGGAAATTGC AGCTAAATATCCAGA[A/T]ATACAGTATGAGGAG ATTATTGTGGATAATTGCTGCATGCAACTTGTCTC
solcap_snp_c1_15484 PGSC0003DMB000000358 509521 ATCAAAGATTGAGCTTGTTGAAGAGGACCCAAATC GGGAAAAACACCAGC[G/A]CCATAAAGAGATAGA AATTCGTCTACATTACTACTCAAATCGTCAATGTT
solcap_snp_c1_15485 PGSC0003DMB000000358 456581 TCAAACTGGAGCTCTTACACCTTTGGTACGGTGGC TTTCACAAGGAATGC[A/G]GAGGGCTGCTGCACC TCCTCAACCACCTAGGCCAGCTGTCAGGGCAGATA
solcap_snp_c1_15488 PGSC0003DMB000000446 432607 ATGGTTACGGCGTTAACCGTCGGTAAACAGCCCAC GTCGGTGTGCTGTGG[C/T]TTACACGTGTCAATT GCTCCGTTCTTCACGTCCATGATGAATTTGAGTGT
solcap_snp_c1_15489 PGSC0003DMB000000446 432602 TGTGAATGGTTACGGCGTTAACCGTCGGTAAACAG CCCACGTCGGTGTGC[T/G]GTGGCTTACACGTGT CAATTGCTCCGTTCTTCACGTCCATGATGAATTTG
solcap_snp_c1_15495 PGSC0003DMB000000234 814750 CAGGCCATGGTTCAACAAGCCATGCAGTACATTGA CCAGACGCCCGATAT[T/C]GACACCAAGATAGAA CTTATCAAAACACTGAACAGTGTGTCTGCTGGAAA
solcap_snp_c1_15505 PGSC0003DMB000000434 242613 TGTTTTAACCCACTTCATCACCACCATTTTCGCAA CCTGAAACCACCCTG[C/A]CATCTCCGCTGAAAC ACCCAAAACAGCTGCTAAACCCACCACTTGATTCC
solcap_snp_c1_15513 PGSC0003DMB000000419 374981 CACCATCTGTCGCAGTTCAAGATATGAATAAGGCG ATGAACCACCAGTGT[G/A]GATAGCCAACTGATT CTCCACAGCTCGGTAGAGACAGTGTCCATCAGGCT
solcap_snp_c1_15521 PGSC0003DMB000000288 39760 AATTAGGCCCTGAGCTAGCACGACAGATGTTGTAG TCCCATCCCCAGCCA[G/A]GTCATTGGTTTTGGC AGCAGCTTGTCTCACTAGTTTCGCACCAATGTTTT
solcap_snp_c1_15523 PGSC0003DMB000000653 189311 ATTTTCGGCCTTAGTGCCACTTTTAAATCCTCAGT TAACATCACCGCGTT[T/C]GTTCTTTGTTCTGCA AAGAGAGGCCAAGCAATAAGTGGAACGCCACAAAC
solcap_snp_c1_15530 PGSC0003DMB000000123 813497 CACGACCAATCTGTTTCACTGATTTCTTGAAAGGA GTCACCAAGTCGACA[T/C]GGCGATCTTCCTCAG CATCCTTTAAGAAATCTTCATCATCATCATCATCA
solcap_snp_c1_15533 PGSC0003DMB000001004 30162 CCAATTAAAGACTAAAAGACAAATTTTATCCATAA TATTTCAAAGCAAAA[A/G]AGCAAAAAATACATC ACATGAAGAAATTAACAAGTCTAGTGCACCATAAT
solcap_snp_c1_15534 PGSC0003DMB000000186 334133 TAATCCCACAACCAGGCTTATTCACATCGAAAGAT CGAACCACAACCATA[T/G]GAGGAGGTGATACAA AGTCTCTCTTAGGGATAGGAATCTTTGTAATATAT
solcap_snp_c1_15536 PGSC0003DMB000000003 1790930 AGTGCTGAACCGGTATTGGCAGTGACAGGAGTAAA TAATGAAGAAGACTT[G/A]GTTTCGGTGTTGATC CAATTAGCCATTTCTGCATTCTTCTACTTCCTTGT
solcap_snp_c1_15547 PGSC0003DMB000000497 273063 GAGTGTCCTGAAATAGTTGCAGAACAGCTTTACAG ATTTCTGCAAGAGAT[A/G]TATGAGCTGTAGGCT TATAATGATTATCAGCTCAAGTAGTCAAAGGTACA
solcap_snp_c1_15551 PGSC0003DMB000000003 4174782 TTTTCCACAAATTGAGGCAACAGCGAAGCTCTAAA TTCCCAAGTTAGAAA[T/C]TTTTTATTTGGAATG AAACCTGCTGCTAACCACGTCATATGTGGGGAGTG
solcap_snp_c1_15561 PGSC0003DMB000000017 1870502 ATGTGATGCCTCTGGAAGACTTTCTAGTGAATGGC CTTCCCTTACTTGAT[A/C]AGAAAATTGAAGATA GGACTAAACAAGCTTGAATTTTCTGCGTTAGTTTG
solcap_snp_c1_15562 PGSC0003DMB000000017 1861631 TTCAACTTCTTTGGTTAATGAATCTGATATCTTTG GTAGGCAGAGCGAAA[C/T]AGAGGATTTGATTGA CCGTTTATTGTCTGAAGATGCAAGTGGAAAAAATC
solcap_snp_c1_15563 PGSC0003DMB000000534 69426 AAAACATATACGCTACTAGTTGGTATGCTGTTTAT GTTTGTTGCAGCTGT[T/C]GGAATACTTATGGCA TCATCAGGGCATCGAAAATAGTGTTTCGGAGACAG
solcap_snp_c1_15579 PGSC0003DMB000000095 234301 TCATTACTTGAGAAACTACTAGATGTAAATGATTC TATGAGTAGATGTGC[A/G]GCATCTGCAGCATCT ACCACTTCTGTTACACAGAAACTGGCAAGGCACAG
solcap_snp_c1_15580 PGSC0003DMB000000095 234271 TCGTGGAAGTCCACGGAAATGGAGATTCAGTCATT ACTTGAGAAACTACT[A/G]GATGTAAATGATTCT ATGAGTAGATGTGCAGCATCTGCAGCATCTACCAC
solcap_snp_c1_15590 PGSC0003DMB000000106 419544 AGAATATCACCTCCTGGATTGTAGAAGAACGCTAA AGAAGCACGTTCTTT[C/T]GCAGAATTAACGATT ACACGATGCTCTATGCTCTTGTATATTGCGTTGCT
solcap_snp_c1_15594 PGSC0003DMB000000106 417425 AGTTTTCAAGGTCAATCAACGGAATATTATCAACA TGTGATGATGACAAC[G/T]TTGTCATCTCACTTG GCCTGTCCGATGGGAGCTTCACGAAGTTTTCGGGA
solcap_snp_c1_15596 PGSC0003DMB000000457 276297 CGTATGAAAATCAACTGATTGTTGAAACGCGAGGA GTTGATAATGGAACT[G/A]TTACATATCTCGAGA AGATCAAGTTCCTGCAGAACAATTTGTTGGCAGCA
solcap_snp_c1_15606 PGSC0003DMB000000403 371916 GCAGAGATGACAGCCCCTGAATCACAACCGAGTCC GGTGTCAGTTCTTGA[C/T]TCATCATTCTACAGG GACGACTCGCCATCCCCTTCACCTATTATGAAAAG
solcap_snp_c1_15609 PGSC0003DMB000000294 675739 ATCATAAGCCCAAAGAGAGCCCCATCACAGTGGAT ATAAAACCGATCATG[C/T]GAAAATCCGCAGTCT TCCAAGGGTTTTTATGACAAGATCATCAACAGCTC
solcap_snp_c1_15612 PGSC0003DMB000000288 644378 ATGAAGTACAATCACATGAGTTTTGGAGGCCCCCC TGTGAAAACTGAGAC[A/C]GTTGAAGAAGCTGAT GAACTTCTCAAGGCTGATGAAAATGATTCTGAAAT
solcap_snp_c1_15614 PGSC0003DMB000000002 5641497 GGTACAGCATTGATGATGTTAGATGCAGATAAGAT GGTTGCTGCTGCCAG[T/C]TCTCGTAATCCTACT CTGGCTGGTGCTCTGACTCGGCTCCAACGGTGTGC
solcap_snp_c1_15618 PGSC0003DMB000000051 382005 TCAGAGAGCTTTGTCTTCAACTCATTACGCAGCTT ATTGATGCATTCTTG[G/A]GCCTGAGGGGTAACA CGCCCCTTTGCATTTTTTGCAGTTTCAGTTCCTTG
solcap_snp_c1_15638 PGSC0003DMB000000360 160329 GGACGCAGGTGTAGTTTAGGGGATCAAGAGCAAGG TAATTTCTCCATTGA[T/G]CTCTGGAAGAAGGCT TTCAAGGATGCCTGTGAAAGGCTTTGCCCAGTTAG
solcap_snp_c1_15641 PGSC0003DMB000000283 823935 GGATCTAGACCGAATAGAGTAGCAGGTTCCGGTTA TTGGAAAGCAACGGG[A/G]ACGGATAAGATCATA ACTTCGCAAGGAAGAAAAGTTGGAATTAAGAAAGC
solcap_snp_c1_15642 PGSC0003DMB000000283 823953 GTAGCAGGTTCCGGTTATTGGAAAGCAACGGGAAC GGATAAGATCATAAC[T/C]TCGCAAGGAAGAAAA GTTGGAATTAAGAAAGCCCTTGTGTTTTATGTGGG
solcap_snp_c1_15655 PGSC0003DMB000000133 1501079 ATTTTCCTCTGTGCCACAGTTGATGACAAACTCTG CATGCGTGCCTACAC[G/A]CCTACTAGCACAGTC GATGAAGTAGGGTTCTTCGAGTTGGTTGTCAAAAT
solcap_snp_c1_15656 PGSC0003DMB000000133 1501128 CGCCTACTAGCACAGTCGATGAAGTAGGGTTCTTC GAGTTGGTTGTCAAA[A/G]TCTACTTCAAAGGTG TTCACCCTAAATTCCCTAATGGAGGTCAAATGTCA
solcap_snp_c1_15657 PGSC0003DMB000000133 1501214 GGAGGTCAAATGTCACAACATCTTGATTCTCTCCC AATAGGTGCATTCCT[C/T]GACGTTAAAGGTCCA TTAGGTCACATTGAATATCAAGGCAAGGGTAATTT
solcap_snp_c1_15658 PGSC0003DMB000000133 1501247 CCAATAGGTGCATTCCTCGACGTTAAAGGTCCATT AGGTCACATTGAATA[T/C]CAAGGCAAGGGTAAT TTCTTAGTCCATGGTAAACAAAAGTTTGCCAAGAA
solcap_snp_c1_15671 PGSC0003DMB000000642 169086 TTATAACACATACAATATAATATATCAAAAATTGG CGAGCTTCAAATTAC[A/G]AGGGACAAACCAACG AAAATGCAAACCCAGAAGTAACATGCTCAACCAAT
solcap_snp_c1_15684 PGSC0003DMB000000103 703049 GAGTCAAAACTATCAATGTCCCTCAAGAATATTAG TTTAGGTGACAAGAA[T/C]CAGAAGCATCCTTAT TTTTCTGGAACTAAACCAGAAAATGCCTATCTCGC
solcap_snp_c1_15689 PGSC0003DMB000000522 142738 GTAGACTTTCTTGTTGATGTTTGGGAACAGGAAGG ACTGTATGATTGAGC[C/T]GTGGGACTTAACTGA TCTTACCCAACCATAGCATTTTCTGTTTGTAAAGT
solcap_snp_c1_15690 PGSC0003DMB000000003 3331523 GGAAACAAATGCCAGAAAAATGTTTGTATACACTG CTCTGCATATGGCGA[A/C]GAGTTTCCGACATAT CAAAGAAAACCATCCGATGTGGGTGCATAAAACGA
solcap_snp_c1_15692 PGSC0003DMB000000683 6271 CTTTGCTTTGTCAATGTTAGGGTTTCAAACGGGTC TTTGAAGAAGAAGAA[G/T]CCAAAGCTCTTGCAT TGCATTAATCTGATCAGTTCTACAAGTATATCTTC
solcap_snp_c1_15694 PGSC0003DMB000001251 14215 TTTGAATCCACAAGTACAGGTGACCTTTTGAAACC CCTTGACTTGAAAAG[C/T]ACCATATTCACGGCA TCTAAAACTTCAACCAAATCGCATCCTATTTCTCT
solcap_snp_c1_15695 PGSC0003DMB000000771 43899 AAAGCGTGGGTCATCTTTTGCCAAATTGTTGACTA TCCCTGAACAGGATG[A/G]CTGGGTTTATAGTGA TGGCAAATCAACATCTTGTATTGCTTTTGTTCTTG
solcap_snp_c1_15698 PGSC0003DMB000000821 85733 CAATCAAGCACAAGGGCAGCCATGCTTGTTAGGAT CAATACTCTTCTTCA[A/G]GGGTACTCTGGCATC AGATTTGAAATCTTGGAAGCTATCACTAAGTTGAT
solcap_snp_c1_15700 PGSC0003DMB000000157 1336924 TTGGTAGAGACGCAGGACAATTGGACATGCTAGAC AGAAATGTCTTGTGT[A/G]CATATCGTCGTATCC AATTTGACAAGCTCATCTGACAACAAATGTTTCAC
solcap_snp_c1_15714 PGSC0003DMB000000100 1383702 CTACTCTGAGCATTTGTGTTACTACCACTTCCATC ATTGGTTCCAGCAGA[T/C]TCAACTTTGGATTCA TCAGAGGGCAACTGGTGCCTACAGACTGGACATGT
solcap_snp_c1_15717 PGSC0003DMB000000309 593075 ATTTTCCAGAGTCTCCCTGAAGCTACAAGGCAAAA TTTACAGATGGCCGC[T/C]GCAGCTGCTGCTCAG GCTGTGCAGCAGCAGAAGAATTTCAGAGTATCGGA
solcap_snp_c1_15726 PGSC0003DMB000000208 895447 TCACTGGATTTTCTGTTGGGGGTCGTGTGGTTGAT GGAGATGGTAACGGA[A/G]TTGAGGGTGTTGAAA TTTTAGTTGATGGACAAAAAAAATCTATCACTGAT
solcap_snp_c1_15739 PGSC0003DMB000000527 289720 TTGTCCGTCGAGGTAAAGGTGGACCACTTGCTGTG GTTGAGTATAGTGAG[T/C]TGGATCCTTCACTCT CTAGTGCAGTAAACCAGGAAACAGGACGTCTTCGC
solcap_snp_c1_15746 PGSC0003DMB000000441 35657 TTTGCAACACTGGCCTAGTTTTAGGATTAGGCTTT TCCTCAACAGCCGAT[T/C]ACAAATCAAAGAAAA TAACAACACCACTAGTAGGCAAAGGTCCGTCTCTT
solcap_snp_c1_15755 PGSC0003DMB000000158 139317 ATTGTGCCAACTGGTTGACCGCGAAAATGAACCAT AGTGCGGCGTAGAGC[G/A]TCCCATGCTTCAGCA ACCATTGGATGGGGCTCAAAAGAGTTCCGGGCTGA
solcap_snp_c1_15756 PGSC0003DMB000000854 37658 TTCCGGACACTGTGAAAGAAGATTCTGCAAGAAAG AATAGAATTGGATTG[A/C]GTATTTGTTTCAATT TGTGGCAATAAGGATTGGATTTTGGAGCTTTGTTT
solcap_snp_c1_15760 PGSC0003DMB000000639 134665 ATAAGCAATTTCAAAGTTGGGTTTTCAAGTGGACG ATGGAACTTCATTTG[A/G]GCGATGGAATAAATA TTTTTTTATATAGAGAAATGGAAGAGGGTTGGTAA
solcap_snp_c1_15762 PGSC0003DMB000000639 116166 GAGTGGACATAGGTCAGATGTTTCCAATTTGCTTT CACCTGCAGACTTGG[T/G]TGCTTTTCTGCAATT ACAGAAGATAACACACATAAGGCTTTATGATGCTG
solcap_snp_c1_15763 NM NM GTTGCGTAGCATCTCATCTGGAAAACAAGTGAGCT TTTTCACACCATAGA[C/T]ACTAAGCTTTACGAG AGATGTCAAGTTGCTGCACAAGTTCAACAATGGCA
solcap_snp_c1_15780 PGSC0003DMB000000293 363246 GGCCGAGGAGGAAATTGCATTGTTTGGCAGTACAC GAAATGATGATGAGT[G/A]ACATTGCTGGTACAA CTTAACTACATTTGGAACTCAAAAAAGTTTTTTTC
solcap_snp_c1_15782 PGSC0003DMB000000731 44191 AGTAAAAATGAGCTTTTTCTCAATTTGGTCATGGA ATATGTCCCGGAAAC[C/T]ATGTATCGCATGTTG AAGCATTACAGCAATATGAACCAAAGAATGCCACT
solcap_snp_c1_15783 PGSC0003DMB000000731 44165 TGAAGCATTGCTTCTATTCAACTACTAGTAAAAAT GAGCTTTTTCTCAAT[T/C]TGGTCATGGAATATG TCCCGGAAACCATGTATCGCATGTTGAAGCATTAC
solcap_snp_c1_15787 PGSC0003DMB000000131 741814 GCTCCGGCACCAGTATTTCTATATTCTCCGTAGTA TAGAGTCTTCAACGC[G/A]AAATCACCACTCCAG GGCAACCATCCGTTAGCGGAAATAAGAGCCTCTAA
solcap_snp_c1_15811 PGSC0003DMB000000044 2266007 AGGTGGAAGTTATTGATATTGCTTCAGCTGCCACT GATTATTGGAGTTAC[A/G]TAGTTGGAAGAAACA ATGTTGATTTATCTAATTTCCAATCAGCAAGATGC
solcap_snp_c1_15816 PGSC0003DMB000000573 276621 GCGGAAAAATTAGCGCAACTGGAATCCCTTGAGGT TCTAAAGTTGAAAGA[A/G]AATGCATTCATGGGT GATACTTGGAAGCCGGAGGTAGGAGGTTTTAGTAA
solcap_snp_c1_15817 PGSC0003DMB000000573 276669 GAAAATGCATTCATGGGTGATACTTGGAAGCCGGA GGTAGGAGGTTTTAG[T/C]AAACTCCGAGTATTG TGGATCGAGAGAGCAGAATTAGAAACTTGGGAGGT
solcap_snp_c1_15818 PGSC0003DMB000000573 289399 CTAATGTATCCACATCATCATTGAGATGATCTTCT ATGCTTTTTTTGAAG[C/A]ATTTGAGAATCCTAA GATAAATATCCTTTATTTTGTATTCCTGACCGACG
solcap_snp_c1_15818 PGSC0003DMB000001045 19090 CTAATGTATCCACATCATCATTGAGATGATCTTCT ATGCTTTTTTTGAAG[C/A]ATTTGAGAATCCTAA GATAAATATCCTTTATTTTGTATTCCTGACCGACG
solcap_snp_c1_15826 PGSC0003DMB000000573 271937 TTGGGGACGTCAAGAATTGGTTTAGGCTTGAATGA GTCTTTGTTGTCTTC[T/G]CGAAGTTTCTTCACC TTCTCATGAATCCCTTTAATTTCAGCTGCAAGAGC
solcap_snp_c1_15829 PGSC0003DMB000000327 134358 GTTGAGGCGAAGGAGCAACTGGAGCTCCGGAACCA GAAATTGGCAGAAGA[A/G]AGTACATATGCCAAA GGGCTAGCGTCTGCAGCAGCGGTTGAATTAAAGGC
solcap_snp_c1_15839 PGSC0003DMB000000039 707572 AGCACACTTTTACTGGTGAAATATCCTTGGAGCAT AAAATATTGTTGCGT[A/G]CAATGAATGAACTAT TAATTGCTTGTTACAAAGTTTGTGTAAGAAAATAA
solcap_snp_c1_15842 PGSC0003DMB000000446 430387 GCCGTACTCACTGCACCCCAATAAGTTCCAATGAA ATGAGGATGGTGCTC[T/C]GGAACCATCCCCTTA GCTGATGGCATCACTGCAACAGCATATCCACTTGC
solcap_snp_c1_15843 PGSC0003DMB000000446 429523 TCGACTAGTCCAGTGTAATTCCAGTTCTTGATCAC ATTGTAAGGTCCGTC[G/A]TGAATCTCAACTTCA ATTGTGTAACCACCATTGTTTATCAAGAAGATGAT
solcap_snp_c1_15853 PGSC0003DMB000000674 119310 GCTATAGGTACGCATTAGATTCTCCAAAGTTGGAG GAGTTTCTGAAAGTC[A/G]GTTTCCCATCTCATA GGCCCTCGTGTTTGGAGACAGGCCAACCACTTGAT
solcap_snp_c1_15855 PGSC0003DMB000000674 126774 AATGGGTGGCAACCAGTTGCCCAGAGCCAATTTAC AACAGGCCTTTCATG[C/T]ACGTGAGAAGCCTTT TCATATGGAGCACTCAACCCACCCACAACAGAAGC
solcap_snp_c1_15858 PGSC0003DMB000000110 1170559 CGGTCATCCAATTTAAATACCAAATGAGGAGGAAA GGGTGGAGAGGAGAA[G/A]TCGGTCATCCGATTC AAAGACCGTATTCTTTTTGAAGTGCCAGTTGGTAT
solcap_snp_c1_15860 PGSC0003DMB000000288 712509 GGCTGCAATTTCATCCAAAAATCAAAGTTGTAGGG GATTTTCCTCAACGC[T/G]TAACAAAAATGACAC TTCCACCAAATCTGTCAACCTTTTCTCTGCTATTA
solcap_snp_c1_15864 PGSC0003DMB000000027 1960311 ACTGAATGTTTAAGCAGTGAAAAATCTTCATGGTT TCTTGAATTTGAAAG[G/A]GGTAATCTAACCAAT GGATTCAAAGACATAGCCACTTCCATTGCCCCTTT
solcap_snp_c1_15868 PGSC0003DMB000000144 196754 CATCACAATTCAGAGACTGGTTGACAGAATTAGGT TTTCGATATAATACA[T/G]GAAAAGTAGATCTCT TTGCTGATGACTCCTGCTATAATAGTGCTTGTTCT
solcap_snp_c1_15870 PGSC0003DMB000000101 216297 AGATGGGCATGTTTTGAAGTTAGATACAGAGGTGG TTTCTCCAACATTTT[T/C]CTGAGATGGTCTGTA GTACTTGATTAATAGCAGACTCAAAAGGCAGTTGC
solcap_snp_c1_15872 PGSC0003DMB000000277 610854 CAAAGTCTTCCTCTGATCTTGATCTGCTAGAGCAG TTGCAGTTCTAACCA[T/C]GGAAGGGGCTGGAAT GTTTCCTGCTTCCTCTGGTGTTTGCTGTTCTTGCT
solcap_snp_c1_15873 PGSC0003DMB000000716 79377 GCTTATATTGAGTTTGCAAATGGTGATGCTGATGC TCTAAACAAAGCTCT[T/G]GAGCTTGATGGATCA GAAGTTGGAGGGTTTAGCTTGAATGTGCAAGAAGC
solcap_snp_c1_15874 PGSC0003DMB000000716 79572 CGTCCTCTGCCTCCACCGCCAAAACGTCCACCACC TCCACCGCGTCCACC[G/A]CCACCAAAGCGGCCA CCACCACCAAAGCGGCCTCCACCACCACGACCGCC
solcap_snp_c1_15876 PGSC0003DMB000000195 463102 AAGAGCATGCACTTTCAATTCCCATGATAGGTCAA CACTTGAGAAGACGT[G/A]CTTTAACATGCCTAT TGCCTGCCATCTTTTACTCTGGTTCTTTTGAAGTT
solcap_snp_c1_15878 PGSC0003DMB000000704 65225 GAAGCTGCTTGGAGCTTGGGGTAAAGAGTAGTCAG GGTTTTGGGACTGTA[A/C]AGGGGAGGAAGAAAA AGGGTTTTGAGGGAAATGGGGTGAACAACATTTGA
solcap_snp_c1_15886 PGSC0003DMB000000018 2792232 AGCAACTGACAAAATGAATAGAGTTACAATTGCTG TTTTGGCCAATTGAC[C/A]CCATTTCTTCCGGAC CATCAAAGCTACATCTTCTGGAAATTGGCATATTG
solcap_snp_c1_15886 PGSC0003DMB000000018 2670468 AGCAACTGACAAAATGAATAGAGTTACAATTGCTG TTTTGGCCAATTGAC[C/A]CCATTTCTTCCGGAC CATCAAAGCTACATCTTCTGGAAATTGGCATATTG
solcap_snp_c1_15889 PGSC0003DMB000000750 53204 TTGAATGTTGATAGTTTGATGTATCCGATCTGAGG AGCATCATCTCCTCC[A/G]GTGGGTAGCTTGCAG ATTCTTGATTTTACAGGATTCAGAGAAACTTTCTC
solcap_snp_c1_15906 PGSC0003DMB000000047 1400427 AATATCTCAAAATTCATACAAATACTTTTCAAATA GTGGCATGTGATCAG[G/C]ATCTAGACAAACAGC CAAACGCAAGTTCCTATCTTTTGTATTTGGACTTG
solcap_snp_c1_15909 PGSC0003DMB000000047 1400012 CCTAGGTAACCCGGTGGCAAGGGAGGGCAAAGCCT TGACCTACCGTCAGT[G/T]GCCACATGTAATTTG GTCAATTGATCATCTGCCAATCCACGTGCCTTGCT
solcap_snp_c1_15910 PGSC0003DMB000000047 1399810 TGGCCGTGGTACTAGACTTTGGGCCTGTGGACTCA CCTTTTTTTGATGAG[A/T]TGAGGGTAGGTGGGG GATGATACTCAACATGCTCGAAAGAAGATGTTGGT
solcap_snp_c1_15911 PGSC0003DMB000000047 1399790 GGGCCTGTGGACTCACCTTTTTTTGATGAGATGAG GGTAGGTGGGGGATG[A/G]TACTCAACATGCTCG AAAGAAGATGTTGGTGGGTCCCGTGCATGGAGGAG
solcap_snp_c1_15912 PGSC0003DMB000000047 1396721 TGATTCATGTATTGATGATTTTGGTGATTTTACAC CATGTTTGGAACTTA[A/G]GAAACTCATTCCTAG TGTTGAAACTTCTGGAGATATCTCAACCTTTCCAC
solcap_snp_c1_15913 PGSC0003DMB000000047 1396656 GATGAACAAGGTAGAATTGAAGTTAATTGTAATGG TGAAGGTGTTTTATT[T/A]GTTGAGGCTGAAAGT GATTCATGTATTGATGATTTTGGTGATTTTACACC
solcap_snp_c1_15914 PGSC0003DMB000000047 1396581 GATAATAAAGTTATGAAAGAAGCATTAAGTAATGT TTTAGTTTCATTTTA[C/T]CCAATGGCTGGAAGA TTAGCTAGGGATGAACAAGGTAGAATTGAAGTTAA
solcap_snp_c1_15925 PGSC0003DMB000000646 9488 TGACTTCAACAAGGAGGCTACAAATGTTGAGTCAT TTAGGAGTTATTTAG[C/A]AGCCATGGGACTAAC TAGGCAGGCCACTGCTCCAAAAGTCTACCGTCAAT
solcap_snp_c1_15926 PGSC0003DMB000000646 9556 GGCAGGCCACTGCTCCAAAAGTCTACCGTCAATAT AGTACTAAGCGTGTT[T/C]TGACTATGGAGAGGC TATATGGAGTACCTTTGACAGACTTAGACTCTATT
solcap_snp_c1_15962 PGSC0003DMB000000104 139207 AAACCCTAACCCTAACCTGAGTTTTGATCCTAAAT GGAACCGGCGAACGA[C/T]GATGACCACCGAGCT AATGGCTCCGACCACAGCCATTTGGCTAAGAAACC
solcap_snp_c1_15965 PGSC0003DMB000000069 1115678 TAAATAGCATCAGCCAGTTCTGGATCAGGCTTGAG TAATTTTGACATTGC[G/T]GATCTTATAGAAGGA ACAGTTACGCGACTAGAAAGGACTCCGTCCCTTAT
solcap_snp_c1_15971 PGSC0003DMB000000122 48690 GTCATTTATCTTCTCGGTTTCTTTGGGATTGGGTT TGTTCAGACGTTTGT[G/A]TCAAGGGGAAATAAT GATTCATGGGATGAAAATGATGAGGAATTTCTATT
solcap_snp_c1_15972 PGSC0003DMB000000122 48699 CTTCTCGGTTTCTTTGGGATTGGGTTTGTTCAGAC GTTTGTGTCAAGGGG[A/G]AATAATGATTCATGG GATGAAAATGATGAGGAATTTCTATTAAAGGAAGA
solcap_snp_c1_15973 PGSC0003DMB000000122 48924 GACGCAGCGCGCTTACAATCACCGAGCTTGGATTC CAATGAGTATGATGG[A/G]ATTTTCCCCTGCACC ACGGATTTAATTATCTCTTCGTCTTCTTCAGACGA
solcap_snp_c1_15974 PGSC0003DMB000000122 48972 CCTTCTAGAGACTTCCCTGTAATCCTCTGCATCAC CTCCTTCCTTATCGA[C/A]GCAGCGCGCTTACAA TCACCGAGCTTGGATTCCAATGAGTATGATGGAAT
solcap_snp_c1_15975 PGSC0003DMB000000122 50453 CATGTGGCTATTAACTAGTTGCCCAGCCGAGATAG CCGACATGAGGGATA[G/A]CTCCCCAGCAAGAAC AGAACCAGCTACTACTGTGGCCAAGAGCCTTGCAT
solcap_snp_c1_15977 PGSC0003DMB000000419 81808 GCTACTTCAACTGCTGTGTGAAAGCTTGAAGTTGA TTGGGATTGATTTTA[T/C]ATATTTTTCTAACTT TTCTGTAATGATAATGTTTCAAGGTGACTTTATGG
solcap_snp_c1_15982 PGSC0003DMB000000419 104120 GCCTCTTGAAAGACCAGGAGGATGAAGGACCCTAC CGGGACCAACGCAGA[A/C]GATGAAGAACCACCA TAAACATATCAACATAGAAATCAAAGAGGTTTGGA
solcap_snp_c1_15983 PGSC0003DMB000000419 104275 GTTGAAAAGAATGTCCATTTCTAAGAACATAGAAA TGAGCTACAAGTAAT[G/A]TTACATTCAAATACA TAACCAATAGAAGGTTATTGTCCCTACTACACGTT
solcap_snp_c1_16001 PGSC0003DMB000000336 387628 CTCATCCAAAAATTGCTGAGTTACTGGAGAAATGC TGGCAACGAGATCCA[A/C]CATCAAGGCCTGATT TTCCTGAGATAATAGAGACATTGCAGCAAGTAGCA
solcap_snp_c1_16007 PGSC0003DMB000000515 179826 CAAGAAGACAATCAAGCTTATGAGAATGAAAGTGG TGATGACTGTGATAG[T/C]GTGAATGACATTGAT TCTGCCCATGACAACTTTAATGAAAGTGACTATAA
solcap_snp_c1_16011 PGSC0003DMB000000464 427109 CATCATCGAAACTATCTAATACGATTGCGAGACAC TAACGTTTGCCACTA[T/C]AACAATTATCACCGG ATGGTCTTGCGTCCATGGAGGAAAATGGTTCACTA
solcap_snp_c1_16013 PGSC0003DMB000000008 1729960 CGATGAGTACCACCACCAGGAACACGAGGGATACG AGAAACGGCACGACC[G/A]GTACCCCATGACTCA GCCGAGGTCTGGTGACCGGCCTTTTTCGACACTGC
solcap_snp_c1_16021 PGSC0003DMB000000241 44817 ATGGAAGCATTTGAGTCACTATTTGGTTTGGAATC ATTTGAATCATCAAG[C/T]TCAGATGAGTTGTCT CAAACAGCAACCCCTGAGGCTGAAACTGAGGCTAT
solcap_snp_c1_16040 PGSC0003DMB000000035 77421 TAATTCCAGAGCTTTGCTTGTGTTGATATGAGATA AGTCAAAGTTCTGGA[C/T]AGCATTGAACAGAAC TACAGATGTGGCATCATTCACAACACCTTCCCCAA
solcap_snp_c1_16052 PGSC0003DMB000000671 162175 TCATATATTTGATTGATGCCCACTATATAACCATT CCCACATATTAGGGC[G/A]ATAAGACCAGAAAAG GCCTTCAATACTAATGACCACCTGATTAGGTTCGG
solcap_snp_c1_16062 PGSC0003DMB000000110 1679996 GGATCATATTGGCGAGCTACCAAGGAAGAATCGAG CACATCTCCTCACTT[C/T]AGAATAGGGTTCTCT TCCTGTTTTTGAACCCAATGCACTTTCCTTTTATT
solcap_snp_c1_16067 PGSC0003DMB000000543 209132 TTTTGCGGATATAATTGCTATTGAAGCTGTACCAC TTGATCGCATCGACC[T/C]CAATTTGGTTCAAAA GGGCCTCGCTGATTTCACTCAGAAGCTAAACACTG
solcap_snp_c1_16071 PGSC0003DMB000000069 1289204 TGCCAGGAGTTGGACCCAGAAGTATGCCATGGGTT AAAACATTTAACCTT[A/G]TGATGGCTTGAATTG ATATAAACAAAAACAAATTTCAAATGTTTTGTTTT
solcap_snp_c1_16079 PGSC0003DMB000000690 102482 CTCTGTAAAAGATTGTAACTTTATATAACCAAAAT CAAGATTTTGAAATC[C/T]GATCAGCAGATATGG AGACCAGTAAAGAGGGAAATGTCGCTTTTCTCGAT
solcap_snp_c1_16080 PGSC0003DMB000000690 85209 CACCACCATGAGGTGATGATTCACTTTGAAGCATG TGATGAAGTCCAGTG[C/T]TTCCACCACTGCCAG AACTCATGCCAAGTTGGCTACTATGCAAGCCTTGT
solcap_snp_c1_16094 PGSC0003DMB000000657 185198 CCCCTTTCACGAAAAATAATGCAGACAATCATTTC TTGATGCATAGATTT[G/A]ACGACCTAAAGGAAA TAAGATAACTGCTGCTTTTTCCTAGAACCGCCTTC
solcap_snp_c1_16106 PGSC0003DMB000000339 303040 GAAGTTGGTGGTCGCCCCTTAAATGTTGAAATGGC AAAACAACTTCCTCC[A/C]AAGGCAGCTGTCTTA AATTCATCAATGGGCTCTTCTTCTTTGCCCTTGAT
solcap_snp_c1_16111 PGSC0003DMB000000312 724820 GTAGCAAAAATATCCGTTATCGAAGAAGGGAGCTC AATGGGTCCTTCCTC[C/T]GGTGGCGCGTTGGTT GTTTCATCGACGGAAATAACCGTTTCATCTGGGGC
solcap_snp_c1_16114 PGSC0003DMB000000312 722833 CAGGACGTGTTGGTGTCGAATCCTTTGAACTCAAC TGTGCTTCACCTTTA[C/T]TGTTAGTTTCTCCAC TAGCAGAATCTCCCATGATAGAGTTCAAGGCAAGC
solcap_snp_c1_16127 PGSC0003DMB000000128 584987 CATTGCAAGACGGGCTTCTGTACAAGAGCGTATAG GTGAAGGTTTCTGTT[G/A]TTGATACCTCAGTTT TATGTGCTTGTGTTCAATTGTAGTTTTGACGTGAA
solcap_snp_c1_16128 PGSC0003DMB000000967 5693 TTGAATTTTTGGGCAATAGAGAAGGCAAACCATAT AGTTTGCAAACAAAT[A/G]TGTTTGTAAATGGTG GTGGAAATAGAGAACAAAGGGTGCATCTTTGGTTT
solcap_snp_c1_16129 PGSC0003DMB000000717 23821 GTGGTTGCTAGTTTGAAAATTTATCCACCATTTGC TGGTGCTGCTGTATC[A/C]GCAATTACACTCGTT GTGGCCTTTGGCTTTGCTGTCTCTCGTCCATGTTT
solcap_snp_c1_16131 PGSC0003DMB000000717 17261 AGAAGGACTACCAGCGCCCAGTAGGAAACCCTCTT GTTTGAAGCGCAGCA[G/A]CTGAGACCAGAGTCT TCCACTTGCAAGATCAATCTGTGCCTCAGAACTTC
solcap_snp_c1_16141 PGSC0003DMB000000009 2284669 TCAGGAATGATACGACCATCACAAAATCTGCCAGT AGGAGGGTTGAAGAA[C/T]GATTCACCATAAGGC GACCAATTAGCTTGGAATTGAGTAGTAGTGTTGAT
solcap_snp_c1_16148 PGSC0003DMB000000338 48904 ACCTTTAGTGATTTCCAAACTGCACTATTACATTT GAAACCTGAACCAAA[C/T]GCAATTTGCCACACT CTATCTCCTTTCTTCACCCTTCCTTTTGATTCTGT
solcap_snp_c1_16169 PGSC0003DMB000000200 842977 ACCAGCCGTGGACAAACACCCGCTTCAATGACAGC TTGAATTTTGTCATT[C/T]GTACCATCAGAAAGG TAAGAAAGTGCCCAGCATGCATCTGTTAGAACCTC
solcap_snp_c1_16170 PGSC0003DMB000000415 247716 ACATCTAAGCTGCTTCAGACCTCAACTTCAAGTGA GAAGATGTACAAGAT[C/T]GATGATCATGTGGCA TGCGCTGTAGCTGGAATTATGTCTGATGCCAACAT
solcap_snp_c1_16171 PGSC0003DMB000000415 247410 TCTTCCCTTGTGATATCATCCTTGTAATCCTGCTT AAGAATTGATTGAGC[C/T]GCCTGGTTGTTTGCT CCAATTGCTGCGGCTTTCCAACCACCGTAATTTCC
solcap_snp_c1_16172 PGSC0003DMB000000415 247287 GAGCATGCTTGATACTTGACTTTCCCATTAGAGAG AAATACCTCAGCAAG[T/C]TCAAGTTTCTCTGAA GTGAGGCTAGTGCTGTCCATTGTCTTACCAAGCAC
solcap_snp_c1_16178 PGSC0003DMB000000988 22614 ATTGTCTTTGGAAGTTTCTTGCTTGCAGCCATGGA AGAAAGGGAAAGGAG[A/C]CAAATCTACATCACT GGCCTGATTCACACTTGTAGTCTAATGCATCTGTC
solcap_snp_c1_16191 PGSC0003DMB000000226 48790 GTTGTATCTTTGGTTGAATCAGCTTGAGCAATCCT AGCAAGACCAAAGTC[A/G]GCGATTCTTGGCTTG CAAAACTCATCCAACAAGATGTTACTTGATTTAAC
solcap_snp_c1_16193 PGSC0003DMB000000251 229772 CACCCACTTGTTGAAGAAGCTTTAAGACTTGCACA TCGCACCACATCCAC[G/A]AATATATTTGGAGGT ATTGATAAGTAAAACAACCTATTAGAAACCCTACA
solcap_snp_c1_16194 PGSC0003DMB000000251 228970 CCATTTGGCACAGTTGGATCATCTGTGTAAGCTGG ATATGATTTAGCACC[A/C]TTGCTATGACCCTTA TACTGTCCAAGAACAACATCTTCAAGTTGCAATGG
solcap_snp_c1_16195 PGSC0003DMB000000251 228931 ATGAAGAGTGCAGCAGCAGAAAATGTTGGAGTGAT ACTGCCATTTGGCAC[A/C]GTTGGATCATCTGTG TAAGCTGGATATGATTTAGCACCATTGCTATGACC
solcap_snp_c1_16196 PGSC0003DMB000000251 228667 AGGCGCAGAACTAGCTCATTGGTTGCTTTATCCAT GTCAGTTCCAAAGTT[C/T]CTTTTGTACAAATTT CCGGGAACATGTCTGAACTGGACCCTGATCTCTGC
solcap_snp_c1_16201 PGSC0003DMB000000361 290687 CTTCGTGGACATCAGTATCCACTGATGAATCTGTA TGAGCGCAGTCTTGG[T/C]GTACTTGCATGCCGT TATGTTGATGAGGTTATCATTGGTGCCCCTTGGGA
solcap_snp_c1_16212 PGSC0003DMB000000272 761895 CAAGCTCAGTGGATGGCAAAACGCCGTCAAGAACG TGAGAGAGGTCGCAG[A/C]GAAGCAGTTGCTGAT ATGTCAGAGGATCTATCTGAGGGAGAGAAAGGAGA
solcap_snp_c1_16221 PGSC0003DMB000000272 759489 CGCTTCTTTTCTAATCCAAGGAAGCCTATGATACT CGCACTTGCTAGGCC[T/A]GATCCCAAGAAGAAC CTCACTACTTTAGTGAAAGCATTTGGTGAATGTCG
solcap_snp_c1_16222 PGSC0003DMB000000272 759203 ACTTCTTCTTTCAATCTTGAAGATGATAGATAAGT ATGATCTTTATGGTC[A/T]AGTAGCTTATCCTAA ACACCACAAGCAGTCAGATGTTCCTGATATCTACC
solcap_snp_c1_16223 PGSC0003DMB000000272 759196 CTTTCAATCTTGAAGATGATAGATAAGTATGATCT TTATGGTCAAGTAGC[T/C]TATCCTAAACACCAC AAGCAGTCAGATGTTCCTGATATCTACCGTCTTGC
solcap_snp_c1_16224 PGSC0003DMB000000272 757894 GCAATTGCTGATGCTCTTTTGAAGTTGGTTGCTGA TAAGCAACTGTGGGC[T/A]AAATGCAGGGCAAAT GGATTAAAAAATATCCACCTTTTCTCATGGCCCGA
solcap_snp_c1_16225 PGSC0003DMB000000272 757531 GCACTGAAGAGCACATCAAAATCTTGGTCGTCAGA CAAGGCAGACCAAAA[C/T]CCTGGTGCTGGTAAA TTCCCAGCGATTAGGAGGAGGCGACATATTTTTGT
solcap_snp_c1_16227 PGSC0003DMB000000272 757156 GAGTATCGTTGGGGGGGCGAAGGGTTGAGAAAGAC TTTGGTGCGTTGGGC[C/T]GCCTCTATCATTGAT AAGAATGGTGAAAATGGAGATCACATTGTTGTTGA
solcap_snp_c1_16229 PGSC0003DMB000000272 756308 CCGCTATCTGATGTTTTACCATTCGACAGCCCTAA TGTCATCCAAGCGGA[C/T]GAGGAATGTAGCAGC ACCGAAATCCGTAGCTTACTGGTGAAACTAGCGGT
solcap_snp_c1_16234 PGSC0003DMB000000695 58785 GCGAAATTTGTGGTTCCATTGAAAACATTGATCAA AGTAACAGCTGAGAT[A/G]TGCTTCAAGTTGAAA ACTGATGTGAGGTATATCAACAAGTTGGACAGTGT
solcap_snp_c1_16250 PGSC0003DMB000000020 2081080 AGAATGATAAAACATTACTGTCCAAGATTTCCAAG AAGTCTCTCTACTGC[G/A]GCATGAACATTGCCT GCAGTGGCAACCAATGCTCTGATATTTTCTTGAGT
solcap_snp_c1_16258 PGSC0003DMB000000118 378848 GTCTATCCCGGAGGGAAGTCCCAAGTTCCAAAAGC TGCTGTCCATTCACT[A/G]ACTTTCTCTGTCCAA GAAGGAGAGTGTTTTGGGTTCTTAGGAACTAATGG
solcap_snp_c1_16261 PGSC0003DMB000000029 910565 ATATCAATCATTCTCACTCGCATTCTTGAATTCTT CCTCGAGTATTCTGC[G/A]GATTTTCATCCTCAA ACAAGAGGCTTCTTCAGGTTTGAACCACCTTCTTC
solcap_snp_c1_16267 PGSC0003DMB000000804 87727 GGAAGATCAGGCAATTCCGGTAGACAGAGTTCAAC AAGCTGAATCGAAAC[A/G]GAGTACTTTTTCGGA ATCCTTTTCTTAATAAGATTGAGATTAACCGGCGT
solcap_snp_c1_16286 PGSC0003DMB000000085 1006632 GTAAACCGAAGAGGAGAAGAAAGAAGAACAAAGGA GATGATGTAAACGGG[G/T]CGATGATGATGATGA TGAGGAAGAGGAAACTAAGTGACGAACAAGTGAAT
solcap_snp_c1_16291 PGSC0003DMB000000710 158245 GTTTGCTGCGGGATAATGAAGCGGAAGTGCGTATA GCTGCTGCAGGGAAA[A/G]CCACCAAATTCAGTC AGATTCTTAGTCCTGAGCTTTCTATACAGCATATT
solcap_snp_c1_16291 PGSC0003DMB000001975 982 GTTTGCTGCGGGATAATGAAGCGGAAGTGCGTATA GCTGCTGCAGGGAAA[A/G]CCACCAAATTCAGTC AGATTCTTAGTCCTGAGCTTTCTATACAGCATATT
solcap_snp_c1_16299 PGSC0003DMB000000480 366185 CGATCTGCCCAAGTGGCAAAGTTTCTTGGAGATGC AAATATAATTCTGCT[A/T]TGACCTGGACTAACC GGAATACAGATGAAAACTAGAAGTGCTTTTTTCTG
solcap_snp_c1_16301 PGSC0003DMB000000324 195522 TCACACGCCCACGGCTCAACGCCTTCGGGTTATAG CAGACTTATTGCGAC[G/A]AATACTGCTAACAAA TCATCGTTATTGTTAATATCTGGAGGTGGAAGTGG
solcap_snp_c1_16312 NM NM AATCAGCCAAATTGGAAGATAGGTGAGTGCGTGGC CACCTGGTGGAGGCC[G/A]AACTTTGAAACCATA ATGTATCCATACTGTCCTCCACACATAACAAAACC
solcap_snp_c1_16325 PGSC0003DMB000000009 2149871 CTACAGATCCAAGACCAAGCCTTCTGATTAAAACA AACATATGTTGTTGA[A/C]AAGCTTTCAAAGATC AAATCACATAGTGGAAAATAAGGAGAAAGGGTTCT
solcap_snp_c1_16342 PGSC0003DMB000000622 35240 AGAATGAGTTTTCCAAAAGAGGAATCGGATAGTTC CATTAAAGATGATCA[G/A]ATCCGGCGAGCCCAA CTGCAAATTCAATTTCACGGAACCAGAAGGGAGGA
solcap_snp_c1_16349 PGSC0003DMB000000876 41420 GTCACCGAGTCATCTCGTTGCTCAATCCCTTTCAT CCTATCCTTTTCATT[A/G]CCACCTCCATATAAA GGAACAAGACTTCCCAAACAGACAATGGATTCAAA
solcap_snp_c1_16351 PGSC0003DMB000000385 406921 TTTCATTGGAGGAGTATTTATGACTTCCGGCAAGC CATTGCTGTCATCAT[T/C]TGAGCCTTCTTCTGC ACCAAGCCCTCACCATAATAACTCATCATTGGGGA
solcap_snp_c1_16353 PGSC0003DMB000000296 794126 GGTAATACATTTGGAAATTATTTCCGCGTTACAAC TTTTGGAGAATCTCA[C/T]GGTGGTGGTGTTGGT TGTATAATTGATGGATGTCCCCCTCGACTCCCACT
solcap_snp_c1_16358 PGSC0003DMB000000189 415107 ATAGGTGATTTTGGAATCTTGGTAAGGTCTGGGTT CAGCGTCTCCAAAGC[T/C]CTCTTCTTTAACTTC TTATCTGCACTAGTGGCACTAGCCGGAACTGCACT
solcap_snp_c1_16362 PGSC0003DMB000000286 356168 GAAGACCAGGAAAAAGCAAGCATGTAGCAGTTTAA GGAGTATAATGAAGC[G/A]GCATGGCACAGTCAC AGTGAGAAACCAGGCCTCCACGTTTGATTCATCAT
solcap_snp_c1_16364 PGSC0003DMB000000286 356857 AAAAGATCCTTCAAGGAATTGTTGAAAGCTGAATT TGTGATGTAAATTGT[G/T]ATGTACACGTACGTG TCCATGGATTTTCTTCTTAACCATACATATATCTT
solcap_snp_c1_16376 PGSC0003DMB000000686 17434 TTTGCCATGAGACATGGCAGGAAGGTCCCCAAACT GAATAGACCTCCTGA[T/C]CAGCGTCGGGCACTT CTGAGAGGTCTCACAACTCAGCTCCTCAAGCATGG
solcap_snp_c1_16381 PGSC0003DMB000000374 208777 TGATGCAAAATCATTGGTTTGTTAGCAAATTCGAC GAGTGGCTTTGGGAC[A/G]CTGAGGGTGAGTGGC CTGAGCCGAGTACCGAACCCTCCAACAAGGATAAG
solcap_snp_c1_16382 PGSC0003DMB000000374 210319 GAAGATGTCCATGTTTGTGATGAAATTTACAGCAA TGGAGGTGTAGTTTT[G/A]CCCCACAAGGAGATC AAATCCAGTATATTGAAACCTGAAATCGTGATGTG
solcap_snp_c1_16394 PGSC0003DMB000000438 10415 ATCCCTCCAAATTCCACTCTCCAGTTTGATGTTGA ATTGCTATCATGGGT[G/T]AGTGTAAAGGACATC TGCAAGGATGGTGGTATCTTCAAGAAGATCCTCAC
solcap_snp_c1_16406 PGSC0003DMB000000130 1459121 AGCAAAGAGAAGAGTTTCTTTTTTCCTCTTTTGAC ATTTCTTTTTCTTCT[G/A]CATTTGATCATCTAC CTTCCTCCTTTCCGACTTGTATCGAGCCATCTCTC
solcap_snp_c1_16413 PGSC0003DMB000000298 784644 ATCAGGAACTTGAAATCGGAGCTCAATAGAGTGGT CTTCCAGTCCCATCA[G/A]AATCTCTGCCCAATC CAGAATCCGGTTTCGCCGATTGGCAGCTCTGGCGG
solcap_snp_c1_16414 PGSC0003DMB000000298 784354 CAAGAATTCCTCGAACCCAACCACTGAACTATACA ATCATCATGGTAACC[G/A]TGCCCACAGGGCAAA TTCTTTGCCATTTCACCCACATTCACTACATCTTT
solcap_snp_c1_16419 PGSC0003DMB000001011 31472 TTTTTTGGGGAAAGTTTTGAGTTGTTTAGTTTGGA GGATTTATTGATGGC[G/A]TCTGCGGAGGTTTTG GGGAAAGGGGCAACTGGAACTACTTATAAAGCATA
solcap_snp_c1_16420 PGSC0003DMB000000539 44615 TTCGATTTTGTTCACTCCAGACGACTAATTTCTCA TCGACTCCACAAGCG[T/C]GCTCCGACTCAGAAG CTCACCATCTCACTGATTTTGTTCAAGAGCTCAGA
solcap_snp_c1_16421 PGSC0003DMB000000288 572857 TACAGTGAAGACGATGTGCACAAAAGCATCAAATA TAATGTGTGGGCTAG[C/T]ACACCAAATGGCAAC AAGAAGCTTGATGCTGCTTACCAAGAGGCTCAACA
solcap_snp_c1_16422 PGSC0003DMB000000288 572896 GTGACATATGCTGATGCCAAGTTCTTTATCATCAA GTCTTACAGTGAAGA[C/T]GATGTGCACAAAAGC ATCAAATATAATGTGTGGGCTAGCACACCAAATGG
solcap_snp_c1_16423 PGSC0003DMB000000288 572999 GAAAATCTGGATGGTTGTATTGTTCTCTGTCAGGA ATCAGGCTTGGTTTA[A/T]CTTCCTCAGCATCTT TGGTTACAGCAAGGGGGATGTTCTGCCCCTTGACT
solcap_snp_c1_16425 PGSC0003DMB000000288 573220 AACACATTCAATTCTGGCATGGGGTTTGGGCCTAA CCGGTATGATACTCG[C/T]GCTACAGGTCGTGGG TGGATGACAGTTGATAACAGGTCTAAACCCAGGGG
solcap_snp_c1_16435 PGSC0003DMB000000363 331177 ATGTTATTTCCTCAGAACTTTAGTTTGAGAAGGAA AGGCATCTTGTCAGC[G/A]AAGGGTGGATCAGAG TATTTTCCGGTGAGAATTTGTGAGGCGACAAACTG
solcap_snp_c1_16439 PGSC0003DMB000000274 165322 AATGGGAATTTAGAGCAGTGGCTACATGGAGCTAT GCAACAGCACGGATA[T/C]CTTACATGGGAAGCA CGGATGAAGATTCTCCTTGGCACTGCTAAAGCGTG
solcap_snp_c1_16439 PGSC0003DMB000000114 792444 AATGGGAATTTAGAGCAGTGGCTACATGGAGCTAT GCAACAGCACGGATA[T/C]CTTACATGGGAAGCA CGGATGAAGATTCTCCTTGGCACTGCTAAAGCGTG
solcap_snp_c1_16441 PGSC0003DMB000000056 1774839 GTCATCTCATAATTAGCTGATCCAAGCTTCCCCAC AGAGCCATTTTCTTG[C/T]GTTGGAGATGGAAAT TGTATATCTCTTGGATGGTGAAATTTGCAGGTAGC
solcap_snp_c1_16450 PGSC0003DMB000000224 357399 GATCTTTTACGATCTGAACCAATGCAGTTGGTGCA ATTGATTATCCCGTT[G/A]GAATCAGCTCATCGT ACAGTTTCTTACCTCGGTGACCTTGGTCTCTTCCA
solcap_snp_c1_16456 PGSC0003DMB000000324 693040 GTTGATAGCACCCAGCAAAATCTTTTGGCCGAAAT TAGTGCTCTGGGAGA[A/G]CAGAAAAAGGTGTTG GAGTCATCACTTGCAGATGTCAGAGCAGAAAATGT
solcap_snp_c1_16459 PGSC0003DMB000000130 477540 CAATGCTTCTTGGAACTGATAGTGAATCAAGGCAA TTCTCATGGATTGTC[A/G]GAACAACTTTACAAC ACTTGTAATGCTCAATGTTGATGACTGCAGTCCCG
solcap_snp_c1_16470 PGSC0003DMB000000558 151150 AGCAGTCACATCCTTGCAAACAGTCATTATGTCAG TAAATACTGATTGTA[A/G]TAGTAATCTAATTTC CTCCTTCCCATCATCCTCATTCAAGTTTAAGACTT
solcap_snp_c1_16472 PGSC0003DMB000000040 257286 ATGGGGTGGGCTTCTGTATTGAAAACCCACTCATC AAGGGGGATAACTGA[C/A]GAGGGAGAGAAAAGA AGATACAGATATTTAAGAGTCTCGGCAAGAAAGAA
solcap_snp_c1_16490 PGSC0003DMB000000339 322585 CACCAAAGCTTATAGATCAGAGTAGATTGTTGTCC CCTGAAGGTGAGGTT[G/A]ATTGCCAAAGCTTTG CATATCATATGCTGTTGCCCCTGTACAAAGTTTGT
solcap_snp_c1_16495 PGSC0003DMB000000281 835206 TTAAAACAAAAGCAATCGTCGAGAGGATTTGCATA TGGAGATGATGTGTT[A/G]ACTCTAGAAGTGGAA CCCCAAGTTGATCAATCGCTAATTATGGCATTAGT
solcap_snp_c1_16496 PGSC0003DMB000000324 342365 ACAGAGGTGAAAGGAGAGGATGTCGTTTGCTTGAT TAAAAATTCTGCCAC[C/T]TTGGCCGGACCATTG TACACATTACATGTCTCCCAGATCCGTATTGAGTT
solcap_snp_c1_16513 PGSC0003DMB000000893 10322 GACTCTGATGGTGATGGGAAAATAACATATGATGA ATTAAAGGCTGGACT[T/C]AGAAAAGTTGGTTCC CAGTTGGCAGAAGCAGAGATGAAGTTGCTGATGGA
solcap_snp_c1_16514 PGSC0003DMB000000893 8036 AGTGGTTATATTGAGCTAGATGAGCTACGAGAAGC TTTAGCAGATGAGTC[A/G]GGAGCATGCGACACT GATGTAGTGAATGAGATCATGCGCGAAGTTGATAC
solcap_snp_c1_16515 PGSC0003DMB000000171 1285020 CGAATAAGGTAATTGATCCCAAAAGCCAAGTCACC AATAGGCCATTTCCC[T/C]AGTGTTTCCGAATAG GTAAACCGGAGAGTTTCACACAAAGTCGAAATGGT
solcap_snp_c1_16517 PGSC0003DMB000000930 43178 CATGACCTCTGGATGAAGTGTATGACTATGTGAGT GGAAGGGAAAGTATG[A/G]CTGGAAATATTTTTA TTCAGTTAAGCTTTAGGTCAGAATCATTGATGGTA
solcap_snp_c1_16526 PGSC0003DMB000000069 61838 CGGCACTCAGAGGCTAAATAAGGTCGGCGTTCTTT GGGTTTCTTCTTTTC[T/C]TCCTCTTTCATTGTG ATGAACCTGTTTAACATTGATTGAGCTTTCTCCTC
solcap_snp_c1_16534 PGSC0003DMB000000909 24601 CGGAGGTGATTTCGTCGGAAACCATGTTCATCTGG TGTTGACCAAGTAAA[T/G]TATTAGAGTTGACCG AATCTGAGAGAAATTTCTGGAGGGAATCCATTCGG
solcap_snp_c1_16535 PGSC0003DMB000000909 24525 GGCTGAGGCGGAGGAGGATTTGTTAATCGTGTAGA GGATAGTAGAGCGGC[G/A]CCGTTGACAATAATC TGATGGATTGCGGAGGTGATTTCGTCGGAAACCAT
solcap_snp_c1_16540 PGSC0003DMB000000441 10090 TTGTCACCTTTTCCATGGACATAAACATTCGTCTG AACAGTGTACGGCTG[C/T]CCTGTCCTGTTTCCC AAGAATTCGAAGTCAAGTTCGTCTCTTACGGTATC
solcap_snp_c1_16542 PGSC0003DMB000000441 10082 TTTTCCATGGACATAAACATTCGTCTGAACAGTGT ACGGCTGCCCTGTCC[T/G]GTTTCCCAAGAATTC GAAGTCAAGTTCGTCTCTTACGGTATCTGTGTCCG
solcap_snp_c1_16548 PGSC0003DMB000001225 7042 AAGGAAAAGGTTGCAAAGGAAATAATTGAAGAAAT AGATGAAGAAAAGAA[G/A]CTTGTTAAATTCAAG GTGATTGGAGGAGATATATTGGACTATTACAAATC
solcap_snp_c1_16550 PGSC0003DMB000000005 3800983 AGGACCACCAGCGAGCCTCCATCACTGGCAGCAGC TCCAAATCTGCATAC[C/T]CCAGCAGCTAACAGC TCCGACCAGCAACAGCTCCAGCCTGCAGCCAGGCG
solcap_snp_c1_16550 PGSC0003DMB000036974 51 AGGACCACCAGCGAGCCTCCATCACTGGCAGCAGC TCCAAATCTGCATAC[C/T]CCAGCAGCTAACAGC TCCGACCAGCAACAGCTCCAGCCTGCAGCCAGGCG
solcap_snp_c1_16552 PGSC0003DMB000000505 291577 ATGGTTGAGTAATAATGCAAAGCTTCGTTAAATCT ATCAATGAAAACCCC[T/C]GCGTTATGATTCGCT TCTTGTTCAACAAGAGTAACGATCTTCGGGTTAAT
solcap_snp_c1_16555 PGSC0003DMB000000046 607733 ATGTATGACGAGTTTGGAAATCTGAAGAAGAAGTT TCGCGCTAAAACGCA[G/A]CGAGCAGAAGCAGCC CAGAGCCTCCCCCCTGGAGTAGGACGCGCTGGATG
solcap_snp_c1_16581 PGSC0003DMB000000462 361688 AGGGAGAAAAAAAGAGGGACGGGGAATAAGAATTT ATGTATAACTTAGTA[T/G]GAAAATTTTCCTTTA GTGAAATGGTTTCATTTGAAAGCATCTGAAACTGA
solcap_snp_c1_16585 PGSC0003DMB000000462 356671 TTTCAGTTGCGGAAGGGTCATCGGCGGCCAATTGG GTGCCTGTGGTTCCT[C/T]TGTCAGCACTGCCAA AAGGAGAGAGACGTGTTATTATACAAGATGGGGAA
solcap_snp_c1_16588 PGSC0003DMB000000728 163088 TTTGTTACTGCCTTGGCCATGCGGCGGAACTCCTT CTTCATTGCAGATTT[G/A]TTCAGCAAAGTTGAA GGCTTGTTCTGTTTCTTGGTCTTTGTTGTAGCAAG
solcap_snp_c1_16616 PGSC0003DMB000000972 21523 GATTATGTCTTGATTTTCTTTATAATTAAGATTGG GAAAAATCGATAATG[G/T]TTTAGCTAGATTTAT TTTCCTGGGCCAAATCGTGGTCACTGTTTGCTCAT
solcap_snp_c1_16621 PGSC0003DMB000000209 301648 TCTTTCATTGCTTCAATTTTTCCGGTAAGGTATCT TCTTTCTCATTTGGG[G/T]TATTATGCTTTTCAA TTTTTGCCAGATCGATCGATGATGCTGTTTCGTTT
solcap_snp_c1_16624 PGSC0003DMB000000576 289114 ATGAACTAGGCCTGCCAGTCATTCGAAAAGCTGGT GTTGAGCATAAGATC[A/G]ATTTCAAACACTCTC CAGCTTTACCTGTTCTTGACAAACTCCTGGAAGAC
solcap_snp_c1_16625 PGSC0003DMB000000576 285901 CAGAAAATCATCCTTATTTTTTTATGGGTGCATCA CCTGATTCAGGTCAA[T/C]TGATAGCCATGCTGT TGGATATGTTAAATGCCAAAAACACAATTGAACTC
solcap_snp_c1_16636 PGSC0003DMB000000096 740440 TGTTTAGCAGCTTCATCAAGGAGCACATCTGCTAC TAGTTTAACTTTTCT[G/A]GAAGCAACAATCTCC AATTTATCTTCCAGAGATGCCACAACTACTTGAGC
solcap_snp_c1_16639 PGSC0003DMB000000213 547688 TTTTTTGATTGAATATTCTAATTAAATTCATCATA CTTTTGCATCACCAC[T/G]TTGGGTGTTAGGTAT TTCCTTCTCATATGGCTTCTCTAATTCCATCTCTA
solcap_snp_c1_16641 PGSC0003DMB000001398 6931 TTAGACTATGCTGGAAATAATATGAAGTACCTTCC ATTTGGATCAGGGAG[A/G]AGAATTTGTGCTGGA ATTCCTTTAGCAGAGAAAATGCTTATGTTTATATT
solcap_snp_c1_16642 PGSC0003DMB000001398 6877 TGGGAAAGTCCACTAGAATTCCAACCTGAAAGGTT TTTGAGTCCCTCGAC[T/G]AATTTAGACTATGCT GGAAATAATATGAAGTACCTTCCATTTGGATCAGG
solcap_snp_c1_16643 PGSC0003DMB000000249 214968 ATTTCATGAAGAACCATAAGACACATAAGGGAACG TTCAATCAATAGAAG[C/A]AGAACTGAGAGTTTA AGAGTGCCAGTAAAACTGGAGAACACCTTGGAAGT
solcap_snp_c1_16651 PGSC0003DMB000000485 259060 GGGCATTTATTAGTCCCATATCCCGATTGAAAGAA GTGATAATTGGGAGT[A/G]GTCGTCGTGGTTCCT TTATCCGAGGGAATGCTTCAACACAACGTTAAGAT
solcap_snp_c1_16653 PGSC0003DMB000000736 109534 TGAGAACATTTGCGATCTGTTTTTTGTTGAGTTCA ATCTTATCGAATAAT[C/T]CAGGCACTTGAAAGT ACTCTGTATCAGACTCAATCTTTATTAACTCCTCC
solcap_snp_c1_16653 PGSC0003DMB000000436 465347 TGAGAACATTTGCGATCTGTTTTTTGTTGAGTTCA ATCTTATCGAATAAT[C/T]CAGGCACTTGAAAGT ACTCTGTATCAGACTCAATCTTTATTAACTCCTCC
solcap_snp_c1_16654 NM NM TAACTCCTCCCAATTTCTCAAATTGTGTAAGCACA ATAAAGTGAAGCAAC[C/T]CGTCCCGTGAAAAAC AATCCTAGGGATGTTAAATTTGTGTGCAACATTAG
solcap_snp_c1_16656 PGSC0003DMB000000614 13761 TTCTTTGCATCTTCACCTTGTGAAGACAGGGGAGA TGGACCCAATCCCAT[G/A]TTCTTCTGAAACAAA TATATCAATTCGTCATTGTATGAGACCAGCAACTC
solcap_snp_c1_16676 PGSC0003DMB000000487 367237 ATGTCGGCTATGTGGTTCGTGCCACAGTACGTGCT TCTTGGACTAGCTGA[T/C]GCTTTCAATGCAATC GGATTGGTAGAGTTCCTTTACTCTGAACTTCCAAA
solcap_snp_c1_16679 PGSC0003DMB000000533 335906 GGGAAACCATCTATTAGAAACTTACGATTTTCAGC TGATTCAATTGCCTT[C/T]TTAATCAGCTTGACA GTCACCTCTGATGGAGCAATACTTCCTTCCTTCAT
solcap_snp_c1_16685 PGSC0003DMB000000150 1188280 TCGGTGACAATTGCTAATGGTGGAGTTCTGCCCAA TATTCACTCAAATTT[G/A]TTACCCAAGAAGAAT GGCAAGGGGAAAGTGGAATCTGCATCTCAATCTCA
solcap_snp_c1_16688 PGSC0003DMB000000866 14143 GGTGTGGAATGTGGCCATGGTAATGACGATAAGGT CCAGGATCGAATTGG[A/G]TTTTACATGAGGTAT TGTGGAATGCTTGGAGTTAGCCCAGGTGACAATCT
solcap_snp_c1_16689 PGSC0003DMB000000225 464185 ATATGAAGGAGAGGCTGAAAAGGGTGGCATCGGCA AAGAAAAAGAAATCC[G/A]GCAAAGAGACAGATG GTGCTGCAAGAGCTGCCGCAACAGAGGCTGCTGCA
solcap_snp_c1_16690 PGSC0003DMB000000269 50989 CAATTAGGTGTTTGCTATGGAATGATGGGGAACAA CTTGCCATCACATTC[C/G]GAAGTTATACAGCTC TACAAGTCAAGAAACATTGGAAGATTGAGGCTTTA
solcap_snp_c1_16690 PGSC0003DMB000000269 87777 CAATTAGGTGTTTGCTATGGAATGATGGGGAACAA CTTGCCATCACATTC[C/G]GAAGTTATACAGCTC TACAAGTCAAGAAACATTGGAAGATTGAGGCTTTA
solcap_snp_c1_16695 PGSC0003DMB000000190 322146 GTGATTTATTTATTTGGGTAAGTGGGGTGCAAGGA CAGACGTATTGTTCA[C/T]CAGCTTCATACCTGT CTCAATTTTGAATATGATTGACATGGCATGGCTTA
solcap_snp_c1_16696 PGSC0003DMB000000190 322073 TTGAATATGATTGACATGGCATGGCTTAGCGCCAT GTTACTTGGAGCAGG[A/G]TGCCTTGCTTTGGGT TATATTATTGGGATGCGACATTCTTCTCCCACTTT
solcap_snp_c1_16708 PGSC0003DMB000000630 15380 CATACCGATTTGGTACTCCATATCAGCGATTTTCT CTTCTAAAGTTGGCC[G/T]GAAATGCGTGTCGCA ATAATCGTAGAGCCATTCCACCATGTCATCGACTT
solcap_snp_c1_16726 PGSC0003DMB000000434 351601 AGCAAGGTGCAACAAAGTATCAACCATGTCCTTAG GAACATAATCCTCTT[C/T]TATTTGTGTCTTTAT TGCCTTGTGATCTTCAATTACATATTTGAAAAATT
solcap_snp_c1_16727 PGSC0003DMB000000099 1503662 CTTTGCTCTACAACAACAAAATCAGGTAGTCACTT GTCCAACATGAACTC[G/A]AACAAAAAATGTACA TTGCTAGCCAATCTTGGGCAATCCAAAACGAAAGA
solcap_snp_c1_16731 PGSC0003DMB000000099 1503345 GAACCCTTAACTTTTGCTGCCACTATATCACCCGA ACCTGCAACATTACT[G/A]ATTAGAACTGACAAG AATATTCCAGAGCCGCCAACAGTGAATCGAACTCC
solcap_snp_c2_24 PGSC0003DMB000000073 1957358 TCTTCAATATTTGTCAACAAACAACACTACTTGTT ACAAGTTCACTATTC[G/C]GAAACTGATCCTTCA TGGAGAACATGAACTTGCAAGTAAAGGCCGCGTTT
solcap_snp_c2_34 PGSC0003DMB000000011 1752731 TGGACGTGATAGTGCTCCTGGTGCAGGGAGAGGTC GGGGCTTGACTAAAG[C/T]TCAGTCTAGAAAAGA TTTTCCACCATCACAGAATGGCCTAGGAAAGAAAG
solcap_snp_c2_37 PGSC0003DMB000000011 2125460 CCAGGAAGAAGTGTGCTTCTATGATATCATGAGAA GGGGTCGTCAAAGAC[G/A]GGAGATAGTGATTGG ATACCGCATTGCAGCTGCAGAACGTGCTGTGATTA
solcap_snp_c2_42 PGSC0003DMB000000555 1668 ATAACAAGCAATGTCCAGGCAAAGATTTGGTGCAC CTATTGGGTAGGTTA[C/A]TATTGGTTGAGTTTT TCATGAGATACGATACATTCACCGTGGAAATTACA
solcap_snp_c2_45 PGSC0003DMB000000011 2460614 TATGACTGTATATTTGGATGTGTGTTATAGACACA TGTATACTAAATGTT[G/T]CAACCACATGTGTGC ATCTTGGGCTGATGCTGCCTTCAACATTCATCCGC
solcap_snp_c2_47 PGSC0003DMB000000012 1195641 TCCTAGCTAACTTTTTGTTAGTATCTGTGAACTCT ACACCAAGTGGTGGC[C/A]AGCTTAGTATTTCAG GCAAGCTAACTAAAGATCGCATAGGAGAATCTGTT
solcap_snp_c2_63 PGSC0003DMB000000011 685283 CGTAGACGTCAGAATTTTGTTGCAGCAATGAGGTT GGAAGAGTTTCTGGG[T/C]GAGCAAGAGGATTTG TTTGGATTTAGGCGCACACTTAGACGTGTTGCCAG
solcap_snp_c2_68 PGSC0003DMB000000026 1918779 CCTCAACTCGGATAGCTCATGAATGATGCCACTAG TTGTAATCATGGTAT[C/T]AAGGAACCACCAAGT TAAGAGTTTTTTTCTGAAGGGATCATCACTTCCCT
solcap_snp_c2_85 PGSC0003DMB000000026 1878906 GTTGATAACCGTCAGATTGTGTCCGCTTCACGGGA CAAGTCTATCAAGCT[G/T]TGGAACACTCTCGGT GAGTGTAAGTACACCATTCAGGACGGAGACTCACA
solcap_snp_c2_86 PGSC0003DMB000000026 1878855 TGGAACACTCTCGGTGAGTGTAAGTACACCATTCA GGACGGAGACTCACA[C/T]TCCGATTGGGTTTCG TGTGTGCGTTTCAGCCCAAATACTCTTCAGCCAAC
solcap_snp_c2_87 PGSC0003DMB000000026 1878758 CAACTATTGTTTCTGGTTCCTGGGATCGTACTGTG AAAATCTGGAACCTT[A/T]CGAACTGTAAGCTGC GTTCGACTCTTGCTGGACACTCTGGCTATGTGAAC
solcap_snp_c2_95 PGSC0003DMB000000073 1340848 ATGCTGATTATAAATGGGTTGTTCCACTAGGAAAT AAGCAGAATCACTTT[G/C]GTGCTTCTGTCGCCA AGGCTCTATGACAATTCTGCTGTACAAATTTGAAT
solcap_snp_c2_95 PGSC0003DMB000000026 2880989 ATGCTGATTATAAATGGGTTGTTCCACTAGGAAAT AAGCAGAATCACTTT[G/C]GTGCTTCTGTCGCCA AGGCTCTATGACAATTCTGCTGTACAAATTTGAAT
solcap_snp_c2_133 PGSC0003DMB000000026 1589935 AATCCAATAGAGAGTTCATTGGTGAAAAAATGGCG TCACAGTCAGCAAAT[T/G]TATGGGTTTTGTTGG GATTAGGATTGGCTGGAATACTCATAATGACCAGA
solcap_snp_c2_148 PGSC0003DMB000000026 1562774 GCAATCACTGCTTTCATGGCTTCTTTTGCAGAAGC CATGACATTGATGAG[A/G]TCCTTCTTATTGGGG CTACTCAGTGCATCCATATAAGCCTTGCGCACTTC
solcap_snp_c2_149 PGSC0003DMB000000026 1553894 GTTTGAGTCCCAGTTGGATCATCATCCAGAACAAT TAAAGTCCTCAAACT[G/A]TTCTCTGTTAGTGTA CATATTTCATTGATCGGATCCACTGGCCACTCTGG
solcap_snp_c2_150 PGSC0003DMB000000026 1553877 ATCATCATCCAGAACAATTAAAGTCCTCAAACTGT TCTCTGTTAGTGTAC[A/G]TATTTCATTGATCGG ATCCACTGGCCACTCTGGAGGAAGGGACTGCAATG
solcap_snp_c2_151 PGSC0003DMB000000026 1553846 CTGTTCTCTGTTAGTGTACATATTTCATTGATCGG ATCCACTGGCCACTC[T/A]GGAGGAAGGGACTGC AATGCAGATTCTTTATTGAGAACAGGAAGTTTGCC
solcap_snp_c2_164 PGSC0003DMB000000026 2842759 CTTCCTGTAATGGCGAAAGCCCGTGTCGGTCATTT TGTTGAAGCCCAGAT[C/T]CTTGAAGCTATTGGA GTTGATTATATAGATGAGAGCGAGACTTTAGCACT
solcap_snp_c2_185 PGSC0003DMB000000026 1374614 AAATTTGCATCAATTAGCTCAGAGACGACAGCTTT ACGGAGTTTAAACAG[A/G]CCGTTACCGAGTTTT CCTCTAATTACATCACTTTCTGCTGTTCTACTTGG
solcap_snp_c2_245 PGSC0003DMB000000026 1143271 GAAGTTTGGCAAGCTTACAATTTTTGCTGAAGAAA GTATCAGCTCAAAGA[C/T]TACTGTCGAGTTGAA ATTAAGATGTTCAGAATTGGAATCGAAGGATTTGT
solcap_snp_c2_308 PGSC0003DMB000000026 869150 CCTGATATCCTCATTTCTAAATTCTCCTGGAATCC CGAAACACCCAATTA[G/A]CAATAGCAAACCCCG GGTATCCATATCATACGCCTTTCGAAAACCTCCTT
solcap_snp_c2_322 PGSC0003DMB000000026 837362 AGATACGATGCGCCAATAAACGCAAACACAAATTC AGGGCAATTAGGCAA[G/A]AGGATCATGATTGTA TCCTTCTGTTGGATCCCCAATTTGTTAAGACCAAC
solcap_snp_c2_323 PGSC0003DMB000000026 837284 TTAGCACTTGAGGCTTTGGCTTGCTTTACTACCTC TGCTGGTGTAAACAG[A/G]GGATTAGCCATTGTT GAAATTGCTCCTAGATACGATGCGCCAATAAACGC
solcap_snp_c2_324 PGSC0003DMB000000026 836918 GATGGAGAAAATGCTAATTTGTATATGCACAGCGA TGATGTGTTGATGTG[T/C]GTGTTGCCTTTGTTC CATATTTACTCACTCAATTCTGTTTTGCTCTGTGC
solcap_snp_c2_325 PGSC0003DMB000000026 836728 TGGTGCAGCACCAGACATGACAGTTCTTACTGATG AAAGATCGTAGTTAT[G/C]AACTAATGGACTCTT AGCAATGGCGAGAACAATAGGCGGAACAAATGGTC
solcap_snp_c2_326 PGSC0003DMB000000026 836699 CGGACGGCATCTTCAAGTTCCTTTCCTAATGGTGC AGCACCAGACATGAC[A/T]GTTCTTACTGATGAA AGATCGTAGTTATGAACTAATGGACTCTTAGCAAT
solcap_snp_c2_327 PGSC0003DMB000000026 834629 ATGGAGGCAATAACCAAAACAAGATTCACCATTTT TAGAGATACTATATG[C/T]TGTTTGATTTGTACC TTATGTTCGATCAATATAATTGCCAGTTTGGCAAC
solcap_snp_c2_328 PGSC0003DMB000000026 834605 TTCACCATTTTTAGAGATACTATATGCTGTTTGAT TTGTACCTTATGTTC[G/A]ATCAATATAATTGCC AGTTTGGCAACGGACGAAATATGTCTGTAAATTAA
solcap_snp_c2_387 PGSC0003DMB000000026 675642 AAGCCTTCATAAGCAATACCACCAGGTCCCATAAA TATTGGCCTACCCCA[T/G]CCGAAATCAGCATCA TGGATAGGCAGCCTAGACCAGCTAGTTATTCCTAA
solcap_snp_c2_388 PGSC0003DMB000000026 675588 CAGCCTGACTTGAAGGCTCTCGTCCGTGGTGCACA TACATTTAAGTGCCC[G/A]AATTTAGGAATAACT AGCTGGTCTAGGCTGCCTATCCATGATGCTGATTT
solcap_snp_c2_389 PGSC0003DMB000000026 675564 TCAGCTCTTGATTATTTGGAATTGCAGCCTGACTT GAAGGCTCTCGTCCG[T/C]GGTGCACATACATTT AAGTGCCCGAATTTAGGAATAACTAGCTGGTCTAG
solcap_snp_c2_390 PGSC0003DMB000000026 675507 TATGCAGCCAGTAAAATCCATGATCAATTGGCTAT AATGGACAACGATTA[C/T]TTAAGATCAGCTCTT GATTATTTGGAATTGCAGCCTGACTTGAAGGCTCT
solcap_snp_c2_391 PGSC0003DMB000000026 675459 GCCACTCCTGTTGCTGTTGCTGGTGATCTCCAATC AAAGCCTATTTGGTA[T/C]GCAGCCAGTAAAATC CATGATCAATTGGCTATAATGGACAACGATTACTT
solcap_snp_c2_392 PGSC0003DMB000000026 675333 CGCTCCACTTGTATGGCACGAGGACTCACTCAGGA TCAAGAAACCAAGTT[G/A]TACATAGCAACTGAT GGGCGTGCTAGGCTCCGACCTTCTCTCCCACCAGG
solcap_snp_c2_393 PGSC0003DMB000000026 675303 TCCTATGAGATGTTGGCAGGACATGTGTGGCGCTC CACTTGTATGGCACG[A/G]GGACTCACTCAGGAT CAAGAAACCAAGTTGTACATAGCAACTGATGGGCG
solcap_snp_c2_394 PGSC0003DMB000000026 675265 CTAAGTCCAAAGAAGATGGAAATACCGTTAACTAC AGCTCCTATGAGATG[T/C]TGGCAGGACATGTGT GGCGCTCCACTTGTATGGCACGAGGACTCACTCAG
solcap_snp_c2_395 PGSC0003DMB000000026 675204 GTTCCTGAAACGAGTGTGTCCATCTTCAAACTAAC CCGCGATCAAATCAA[T/C]ACCCTCAAAGCTAAG TCCAAAGAAGATGGAAATACCGTTAACTACAGCTC
solcap_snp_c2_396 PGSC0003DMB000000026 675151 AGCCACCTCCCACTCTCAAGGCAACAGAAGAAAAT GCCCCGAATGCAGAA[A/C]CTGTTCCTGAAACGA GTGTGTCCATCTTCAAACTAACCCGCGATCAAATC
solcap_snp_c2_397 PGSC0003DMB000000026 675150 CAGCCACCTCCCACTCTCAAGGCAACAGAAGAAAA TGCCCCGAATGCAGA[A/T]ACTGTTCCTGAAACG AGTGTGTCCATCTTCAAACTAACCCGCGATCAAAT
solcap_snp_c2_398 PGSC0003DMB000000026 675118 CACCTCAGCCTCAGTTCCCCCACGTCGAGTACCAG CCACCTCCCACTCTC[A/G]AGGCAACAGAAGAAA ATGCCCCGAATGCAGAAACTGTTCCTGAAACGAGT
solcap_snp_c2_400 PGSC0003DMB000000026 672898 TCAGCTTCCACAAAAAGCACACCTTGCCCTTTACA ATCAATCTCAATACG[G/C]CCATCTTCATCCCTG CACAGCCTCCCACCCATCGGATAAAACGGCACTAG
solcap_snp_c2_401 PGSC0003DMB000000026 672799 AGGGCTTTGCTTAGTGCCTCCTTAAGCACTTTTCC GTCGAAAAAATTTGG[G/C]GATCCCGTTGGCCTA TAGAAATAAACACTGGGCGTGTGGAAATTAGGCAC
solcap_snp_c2_422 PGSC0003DMB000000026 579598 GCACCACCATCCACACGGAGTAAGAATTCTGTTTT GTCACTCTTAGCTTC[A/C]GCATCCTTGTGCATG GAATCAAGCACGTCTTTTACCTGGAAACACATGCT
solcap_snp_c2_429 PGSC0003DMB000000026 563892 CATGGCTGGCCCTTAGTGCTGAAACCTTCAACTGA GCCCAAGAAAAGGAA[G/A]ATCAGGATTGCAAAA GCAATCATGAAGATACCCACATACTGATACTCAGT
solcap_snp_c2_430 PGSC0003DMB000000026 561624 AGTACACCAGAAAGTGTCTCCACTCCAAAGAAAAT ACCAACTATGAGGGG[A/C]GTGAGCATGACTAGG GCACCTGGTGGAATCATTTCCTTGATAGATGCATC
solcap_snp_c2_534 PGSC0003DMB000000552 24698 TGGAGGAGGAGGCGGATGATTGGCTACTCCTTGAA ATGTACCGTAGTAAT[A/G]GTTTGCCGGCAAGGG TTCGCCGGTGGCCGAAGAGGCCCTATTCTTCCCGT
solcap_snp_c2_549 PGSC0003DMB000000080 943654 ACTCTAGTCTAGTAGTACTAATAATAATAATATTG TGTCATAAATTGTTT[G/T]TTGTATTACGGATCC TACTTATATGGATCCATACATCTATCTTTGTTTGA
solcap_snp_c2_566 PGSC0003DMB000000023 2703631 CGGCATTCCCATCTCTAATTCCTGATACGCAACAC CATCTTGATGTCTCT[T/C]CTTCCTTAGCTTGCA GCAAGCCCATGTCCCGCCAAAAAGTAGGGCTACAA
solcap_snp_c2_578 PGSC0003DMB000000040 2520993 CTTTGCTCTCTTCTCAAGACTTTCGCGTTCCTTGC CAAGTTTCATCACCA[G/A]GCTATGGGCATCTTC CAAATTTTCTTGGGCTTCTTGTGAAATTTGCTTCT
solcap_snp_c2_616 PGSC0003DMB000000026 2144926 GACGTGATCTTCATTGCCACCCGGAGGATAGTAAG GCCCCCAAAGAGAGG[C/T]TCTGCTGCTCAGCGG CCCCGCACCAGGACCCTTACTTCTGTCCATGATGC
solcap_snp_c2_617 PGSC0003DMB000000026 2144872 GCTGCTCAGCGGCCCCGCACCAGGACCCTTACTTC TGTCCATGATGCCAT[T/G]TTGGAGGATTTGGTT GTCCCTGCAGAGATTGTAGGGAAGCGAACTAGATA
solcap_snp_c2_634 PGSC0003DMB000000435 379876 TCTCCAATCTGGGAGACAAAATGAGGGTTTTCTAT TACAAGTCTACAGGA[C/T]ATTTACAAAGTCGCA TAGCTCTTACGGACATTCACCCGCCAGAGCTACAC
solcap_snp_c2_644 PGSC0003DMB000000036 1657266 ATCAATAAAAGCATCCAAATCTTCTCCCTGGAGAA CATCATCTATGGAAT[G/A]CGTTGTGATGCCAAC ACGGTGATCAGTAACCCGTCCTTGAGGGAAGTTAT
solcap_snp_c2_646 PGSC0003DMB000000036 1540717 TGGGAATATCTTTGGTGGTGTTTCAGTACCCATTG TTTGTATGGATTTGC[G/A]CTCCTAACCTTGCCA TTCTATGTCCCCCCAACACTGGAGAAGGCCCCATA
solcap_snp_c2_648 PGSC0003DMB000000036 738042 ATGTGATTAGTAAATTGACATCCACAGTGGACAAA ACAGGGGATTCAGCA[A/G]GTAATGGTGTGGCAG CCTTTTCGACTGGCTTGAAAGAAGTCTCTGGTAGA
solcap_snp_c2_649 PGSC0003DMB000000036 737941 GTTGGGCTTCTTGCTATCGATGCATTGAGACATAT AATTCTCATTGTTGA[G/A]GATTTGGTATCGCGA GGTGCCACACTTGTTGTGTATTCTTACGGGTCTGT
solcap_snp_c2_657 PGSC0003DMB000000036 353758 AGAGGCCAGATAAAGCTAAACTGTTTGAGGAAGTT CGGGGAGACTGCCGA[A/G]AAATGTTTGGCTGAT TATGGAATTGATAGGCCAACAATGGGTGACGTATT
solcap_snp_c2_658 PGSC0003DMB000000036 353710 CAGTGGCAGAAGGATGGACAACTAGACAAGATTGT TGATCCCCATATCAG[A/G]GGCCAGATAAAGCTA AACTGTTTGAGGAAGTTCGGGGAGACTGCCGAAAA
solcap_snp_c2_659 PGSC0003DMB000000036 353536 GGTGTAAAAGGAAGTTTTGGCTACCTTGATCCGGA ATATTTTCGGAGGCA[A/G]CAGCTTACTGACAAG TCAGATGTTTACTCGTTCGGAGTTGTTCTATTTGA
solcap_snp_c2_660 PGSC0003DMB000000036 353383 CTCCACTACCTTCATACAGGTTTCGCTCAAGGAAT CATCCATCGTGACAT[A/C]AAGTCAACTAACATC CTCCTTGATGAAAATTGTGTTGCTAAGGTTGCTGA
solcap_snp_c2_661 PGSC0003DMB000000036 353323 GGCATATCACCCTTATCTTGGAAGAAAAGGCTTGA GATATGCATAGGTGC[A/T]GCAAGAGGTCTCCAC TACCTTCATACAGGTTTCGCTCAAGGAATCATCCA
solcap_snp_c2_662 PGSC0003DMB000000036 353055 TTTTGATAAGAGTTTGCTAGTCGGTTCTGGTGGCT TTGGGATGGTATACA[A/G]AGGTATTCTTGGAGA CAACAGAAAGGTTGCTATAAAGAGAGGTGTGCCAG
solcap_snp_c2_664 PGSC0003DMB000000036 21701 GGTTGATCAATTTTATTTATGACAGGAATTATGGC CAGGTTTGATTCAAA[C/T]GCGAGGTAAAAATTA GCAACAGTCTGTGCCTGCACACCTTGGGCTGCATC
solcap_snp_c2_677 PGSC0003DMB000000299 506733 AACTCAAACTTGAAAAGTGGCGAAGATTCAATTTT AGCAAAAATCATCCT[A/G]AAATGAGCTCCGCCA TGAATTTCCTCTTCGAATTTCATAAAATTTGATTG
solcap_snp_c2_680 PGSC0003DMB000000053 1554929 TCTTATTGATCCCAAAATTAAAAGGCCCATATCCA TGGGCAAACATCAAG[C/A]TAGAGAAGATGCAAG GATGACAACATTTACAAGATTAAGAGTTCCCCCAA
solcap_snp_c2_681 PGSC0003DMB000000053 1555015 CTTTTCAGTTTTGGTTAAAGAAACTGACTGGCCAA TTGCAAGCAAACCTA[A/G]TATTTTAAAAACAGT AGTAGTGCAGACTGACGGTATCTTATTGATCCCAA
solcap_snp_c2_682 PGSC0003DMB000000053 1980818 CATGCGCTCCTTGTAGCAGCTGCTTCTTTATATGT CTTGCTTGAATCAGA[A/C]CTTTTCTGTGATGGT GCTCAGGATGAGTTAATGATAAATAGAACATCAGC
solcap_snp_c2_686 PGSC0003DMB000000299 268061 ACAAGTAGAACGCCGATACTTAATCGTATTTCATC TTCTCGAAGTATTCG[C/T]CTTGGTCAAGTACAG CCTCAAGCACCAGGTCATCGAACTGTTTTTCTGAA
solcap_snp_c2_689 PGSC0003DMB000000009 3221322 TTGATGATCGGGAAGCGGCTCAGCAACGCGAGATT GAAAAACTGCTCCAG[G/A]AAAACCGCAGTCTAG CGGGCGCGCACGTCTCTCTTAACCAGGAGCTCTCC
solcap_snp_c2_694 PGSC0003DMB000000299 233908 TCTACTATAAGCTAAATTGTCTTGGGTCAAAAAAG TACATTAATGTTCAG[G/A]GAGGAAAATTTGTAC TATCTGGAAGTTAGTTTTCTCGAGGTAGCTTTGAC
solcap_snp_c2_701 PGSC0003DMB000000009 3602811 ACACATCCAAGTTGATGCATAGCTAGTGCCTTTTG CCATCTTTCAGTCGC[G/A]CACTCCTTCAATCTC TCCAACAACATAAGTGTAACTTTGGACATCATGTT
solcap_snp_c2_730 PGSC0003DMB000000287 354989 CTTGAATGTTTTGGCCTAGCTCCAGTGCTTATTCC ATTCCATAGGATACT[C/T]CCTCCAGGACTCTGC AAGGGGCCAACGTGCTCCATCACAGGCCAACCAAA
solcap_snp_c2_735 PGSC0003DMB000000287 354474 AAGGTGATTCACCACCAGTTCCTTGATCCATGGCT AAGAAGTGCTCAAGA[A/G]TCCTCTGTACGCAGT CAACATTATAAAGTGTTTCCATCGAGTAAGAGAAA
solcap_snp_c2_736 PGSC0003DMB000000287 354316 TGCATATTCAGGAACAGAAGCAGCAAGAGTCTGAA ACTTGGGAAGCTTCA[A/C]GTTAACATCTGGGGC AACCTCAGCAAGATATCCATCGATTAGTTTTGCCA
solcap_snp_c2_758 PGSC0003DMB000000287 118638 CCAATTTTCGTATAGGGAATTTGTTTGGTTTTGAA GCTTTTTGATGACTT[G/A]ACAATTGGCCATATG CGACTTGTATTAGTACCGATATTATAGAGGATTTT
solcap_snp_c2_759 PGSC0003DMB000000287 118609 TTTGAAGCTTTTTGATGACTTGACAATTGGCCATA TGCGACTTGTATTAG[T/G]ACCGATATTATAGAG GATTTTTGCTATTTCTGTGAAATTGACAGCACTCA
solcap_snp_c2_765 PGSC0003DMB000000287 33942 CTGGACGCTCCCAGTAGGGAGCGGCTAAATCTGCA ACAGTGAGATCATCT[T/C]CATCATCAATGAGAT CAAACTGCTGGGTGGACCATCCAAAATCTGCTTGA
solcap_snp_c2_773 PGSC0003DMB000000359 508981 GAGCTAAGGGCTTGCCTTAAAGATTCGAGATCATT GACCCTGCAAAATAG[C/T]ATATACATCCTTTGG AGATCTTCAATACGATTACCATCCATCAACACTGT
solcap_snp_c2_779 PGSC0003DMB000000359 214402 CCTGAAGAACCAAAATTGAGCACGGAGGCCATGAT ATCAAGTCCTCAGGG[C/A]GATTCTAAGGAGAAC TCAGTTAACAATGTAACGGATGAGACTCCTAAACC
solcap_snp_c2_783 PGSC0003DMB000000569 259575 CACAAATGTCTACAATGTTTGTGGAGCAAGGGATG GTGATGGACACTGCC[A/G]TTGGTTCCTTCAAAA TTCCTGCAGCATCTCTTTCAACTTTCGATACCATT
solcap_snp_c2_784 PGSC0003DMB000000569 259550 GGTATAGTCTTTTCTGCTGTTTATGCACAAATGTC TACAATGTTTGTGGA[G/A]CAAGGGATGGTGATG GACACTGCCATTGGTTCCTTCAAAATTCCTGCAGC
solcap_snp_c2_785 PGSC0003DMB000000569 220674 TTAGCAGCTTTACTCAAAGGAGCTCACCCATACTG GTCACCAGCAATGAT[T/C]CGTTCAGCTCTCATG ACAACTGCATACACCCAAGATCAACAAGGCAATCC
solcap_snp_c2_791 PGSC0003DMB000000320 521591 CTCCTCCTTCTGTGTATGACACTTTTGTCAATTGT CTCACAAAAAACTCA[A/G]TTCCTCAATCAGAAA TCTCGAAAATTGTCTACTCTCCAAACGATCCTTCG
solcap_snp_c2_796 PGSC0003DMB000000320 522268 GTACCACAAACCGTGACCTATTTCAGAGTTGAAAG GTTTATAGAAGATAA[C/T]ACTACCACCGACGCT GTTGTTCAATGGCAGAATGTTGCTAGCAAAATCGA
solcap_snp_c2_803 PGSC0003DMB000000706 50641 TCTTGAACTGCATTATGTAAGATCTCGTCAGCAAC TTGATCACCATCCTC[T/C]GCACAGGATACAACT ACTGGGACAAGTGCTGCAATGCGAGCCCAAGATGG
solcap_snp_c2_804 PGSC0003DMB000000706 46839 TTGAATGGTTCACACCGGATAAACCCAAACAAATC GCTTGAACAGCTGAC[C/T]GTTTGACACCAGCAT CAGACAGTGCTTCTGCTATAATCTTTTCCAGTGTT
solcap_snp_c2_805 PGSC0003DMB000000706 45378 GGATCAGGGAGATTATGGATATCGGAAAAGGGAAG AAGTGGCATGCAAAC[G/A]CACACAGTGGAGGTA GTGCCGCCATCAACACCCAACATCACCTTGCAATC
solcap_snp_c2_806 PGSC0003DMB000000706 45306 CCATCAACACCCAACATCACCTTGCAATCATCAGA TTCTGAACCCATTTT[T/C]ACCAACAACAACACC AGTTTCAATGGGGGAAGGATTAAGATATTTTAGGA
solcap_snp_c2_811 PGSC0003DMB000000287 810320 TTGTGCTTGAGTTGGGCCCCCCTGTAGTTGAGGTG GCTGAACTTGTTGAT[G/T]CGGCTGGTGCTGTTG TATAATGGGTGTCTCAGTTGCTGTAGATTTAACAG
solcap_snp_c2_813 PGSC0003DMB000000287 704232 CTTCACCCTCTCCGTCCCCTTCTGTTCCATTATCT CTCCCATTCCCTCCA[C/T]TTCTTCACCCCATCT CTAGCGAAGACCACTAGTCGCCCCTTTCTCTTGCC
solcap_snp_c2_816 PGSC0003DMB000000287 670800 TTCATTATCTGATGATGGCAGGTCTATTAGTTGCC CGCTTAGGTCTAGGT[T/C]TATTACCTTGCCCTG GCATCTCAGTCGTCAATGCATACATCTTCACAGCA
solcap_snp_c2_826 PGSC0003DMB000000149 233538 AAAACAATTTTGACATAACTTTCTAGTATGATGGG GCTTCAGATTTGAAG[T/C]AATAGCATCTTTCTC TTGTCATCGCTGCTTCATTTTTCTCCCTGATTGTG
solcap_snp_c2_873 PGSC0003DMB000000149 126272 TGTTGCCTGAATCTCGCTCACCCTCACCACGAACA AAAAGACTAAGAAGA[G/A]CAGAACGAGAAGCTG AAGAAAAGCCAAGGGAGCGGGAGCCTGAAAAAAAT
solcap_snp_c2_919 PGSC0003DMB000000421 73525 AATGCTTTCCCTCAGCTGCTCTCTTGACCAGCCGA GCGGCAAGCACTTCA[T/G]CCCCAACATCCAACA ACACGAATTTAACAATACTTGCATAAGAACCTGGT
solcap_snp_c2_939 PGSC0003DMB000000421 151128 TGCAGAGCTTCTTCTAACAAAAACTGAGATTGCTC CATCAACTCAGGACT[C/T]AATCTGAACATCAAC ACACAAAACTCCATCTGATTAAGAGCTCCATCACC
solcap_snp_c2_942 PGSC0003DMB000000421 187070 TCATCTTCATCGTCGTCATCAATTTCACTGTCAGT ACTCCCGTATTCATC[C/T]TCATCTTCGTCATTA TCAGTTTCCGTTTGATAATTTTCTTCAATTCTTTC
solcap_snp_c2_944 PGSC0003DMB000000421 203893 CCACCATCCTTCTCATCAGGATACCTCACAACCAC AACAGGGCAAACACA[A/G]TGCCTAACACAGTAA TCACTAACACTTCCAAGCCTCCCATCATTTCCTCT
solcap_snp_c2_950 PGSC0003DMB000000421 210183 GATGTAGCCTATTCTTTCAATGAAGATGAGGAAGA TGAGGAGGAGGTTAA[A/G]GTGAAAGCTGATTCA AGCAGGATGGAAGCCTTGTATTCCAAGGCAACACT
solcap_snp_c2_984 PGSC0003DMB000000421 271577 AAACTCCAGTACCAACTGAAGAATCTCAGCTGGAT GCCACACAAACCGTG[A/G]TAGAACCTCAGTACA GGCCTCGTGTCACAGAGTCAAAGTTGCAGAAGATC
solcap_snp_c2_989 PGSC0003DMB000000421 291339 GCCCCCTTGCAGCACCGATACAAATCTCAAGACGC TGCTTCCATGAGATA[T/G]GTGGGAGATCTGTTC CATAAAGATGACTTCTGAGAGGACCATTTGCCATG
solcap_snp_c2_992 PGSC0003DMB000000421 373784 ATGAAGATTTCTGCAGCAATTTCCTTCTTGAGCTA CCACTAAATCTAGTC[T/G]CTATAGGAACCACAA GGTTTTGAGCTCCTTGTAGGATGAGATCAATAGCT
solcap_snp_c2_1000 PGSC0003DMB000000421 397921 TGACATAGAAACATTGCAGGAAGACATTCGAAATT TACCTCTACTGTCAG[C/T]GTTAAATGTTAGTCA CAACAAGCTAACCCATCTTCCAGCTGCTATTGGAG
solcap_snp_c2_1001 PGSC0003DMB000000421 397953 GTGGAGCTACAGAAGCTGATTTTGGCTCATAATGA CATAGAAACATTGCA[G/C]GAAGACATTCGAAAT TTACCTCTACTGTCAGCGTTAAATGTTAGTCACAA
solcap_snp_c2_1066 PGSC0003DMB000000312 598396 CAAACGAACGAGTGCCAAAGCCTACTAGCATGGAT AACAAGACTTGTGTA[T/G]CTGTTACTACTCCCG ATCTCTCTATAGCTTCTGTTGTTAAGTGCTTGAAT
solcap_snp_c2_1077 PGSC0003DMB000000312 470666 GAAGAAAAGTGGATTGGCATATCTCACAGCATTGT GGATACCAACATTGT[C/T]ACTACACTCAATTCT TGCCTTTTCATATCCTGACACACTCTCTTTGCAGT
solcap_snp_c2_1090 PGSC0003DMB000000312 465206 TCAGCTGCTGAACTAGTGACGCTGAATCCGACAAG TGAATATGCCCCTGG[C/A]TTGGAGGACACACTC ATCTTGACCATGAAGGGTATTGCTGCTGGAATGCA
solcap_snp_c2_1091 PGSC0003DMB000000312 465194 ATGGAATCAAAATCAGCTGCTGAACTAGTGACGCT GAATCCGACAAGTGA[A/T]TATGCCCCTGGCTTG GAGGACACACTCATCTTGACCATGAAGGGTATTGC
solcap_snp_c2_1092 PGSC0003DMB000000312 465098 TCCATGTATTCCTTGGAAATATGAGGCCTCAGCTT GACATGGTAGTTTGG[A/G]TCACGTATACGCTTT AGAGTGTAGGCTTGCAACACGTTTAAGGTTGTGAT
solcap_snp_c2_1093 PGSC0003DMB000000312 463970 AGCCGTCCATCAAAGCGTAAACCCAGTGGAGGCAT AGAATCACTCAGAGC[C/T]ATTCCATGGATCTTC GCCTGGACCCAGACAAGGTTTCATCTCCCGGTCTG
solcap_snp_c2_1094 PGSC0003DMB000000312 463964 ATTGGCAGCCGTCCATCAAAGCGTAAACCCAGTGG AGGCATAGAATCACT[C/T]AGAGCCATTCCATGG ATCTTCGCCTGGACCCAGACAAGGTTTCATCTCCC
solcap_snp_c2_1095 PGSC0003DMB000000312 463704 CTTGAACATGGTATGCATCCACCAGTCTCTCCAAA ACCCGAATGGCGTGC[G/A]CTTATGGATGAAATT GCAGTTATTGCTACAGAGAAGTATAGGTCAATTGT
solcap_snp_c2_1096 PGSC0003DMB000000312 463695 GCTGCTACCCTTGAACATGGTATGCATCCACCAGT CTCTCCAAAACCCGA[A/G]TGGCGTGCGCTTATG GATGAAATTGCAGTTATTGCTACAGAGAAGTATAG
solcap_snp_c2_1097 PGSC0003DMB000000312 463465 AGGCTCAAGAGGAGCTTGTAAAAGTTGCCAAAGAA CATGGTGTGAAGCTA[A/G]TTATGTTCCATGGTA GAGGTGGTACAGTTGGAAGAGGAGGTGGCCCCACC
solcap_snp_c2_1098 PGSC0003DMB000000312 463455 CAGCTATATAAGGCTCAAGAGGAGCTTGTAAAAGT TGCCAAAGAACATGG[T/G]GTGAAGCTAATTATG TTCCATGGTAGAGGTGGTACAGTTGGAAGAGGAGG
solcap_snp_c2_1099 PGSC0003DMB000000312 463173 GCAGAACTTCCATCAGACTGCTTCGGGGCATACAT CATCTCAATGGCCAC[C/T]GCACCATCTGATGTG CTTGCAGTTGAGCTCCTACAACGTGAATGCCATGT
solcap_snp_c2_1100 PGSC0003DMB000000312 463042 ATCGTGAGTGGTCTGAAGAACGTAGACAGGAGTGG CTTCTTTCTGAACTC[G/T]GCGGCAAGAGACCTT TATTTGGACCCGATCTTCCAAAAACAGAAGAAATT
solcap_snp_c2_1101 PGSC0003DMB000000312 461684 GCTCCAACTCCACAAGATGAAATGAGAGCTGGAAT GAGCTACTTTCATGA[A/G]ACTATTTGGAAGGGT GTTCCACAGTTCCTTCGCCGTGTTGACACAGCTCT
solcap_snp_c2_1102 PGSC0003DMB000000312 459980 AAGAAACTTTCAAGAAACTTGTAGAGGAGTTGAAA AAGTCTCCTCAAGAA[G/A]TTTTCGATGCTCTGA AGAATCAGACGGTGGATCTAGTCTTAACTGCTCAT
solcap_snp_c2_1103 PGSC0003DMB000000312 459954 CAATGCAACAACTGAATCTGATATTGAAGAAACTT TCAAGAAACTTGTAG[A/G]GGAGTTGAAAAAGTC TCCTCAAGAAGTTTTCGATGCTCTGAAGAATCAGA
solcap_snp_c2_1104 PGSC0003DMB000000312 459953 ACAATGCAACAACTGAATCTGATATTGAAGAAACT TTCAAGAAACTTGTA[C/G]AGGAGTTGAAAAAGT CTCCTCAAGAAATTTTCGATGCTCTGAAGAATCAG
solcap_snp_c2_1105 PGSC0003DMB000000312 459808 CTGTTGACAAGTTTGGATCCAGGGGATTCCATTGT CATTGCTAAAGCTTT[C/T]TCTCACATGCTTAAT TTGGCCAACTTGGCCGAGGAGGTGCAGATTGCCTA
solcap_snp_c2_1106 PGSC0003DMB000000312 459758 CGGAGTACGAAGGAAAGCATGATCCAAAGAAGCTG GAGGAGCTTGGAAAT[C/G]TGTTGACAAGTTTGG ATCCAGGGGATTCCATTGTCATTGCTAAAGCTTTC
solcap_snp_c2_1108 PGSC0003DMB000000312 441385 CATGCTTGTCTTAATGGACAAGTGCACGGACCGGG CGGTTCGGGTTGCCC[A/G]AAAAATAGGCAACCA TGTAAGTGAACCTTAGTCTTTCCGAATTGATCGAG
solcap_snp_c2_1109 PGSC0003DMB000000312 441355 AGTCTACCAATTAGGGCATCTAGGCTTCCCCATGC TTGTCTTAATGGACA[A/C]GTGCACGGACCGGGC GGTTCGGGTTGCCCAAAAAATAGGCAACCATGTAA
solcap_snp_c2_1113 PGSC0003DMB000000312 433746 CACTTGATACACAATATACTCAGCAATTGCTTTTG ATAAATGAGATAACA[A/G]AGCTCTCAAAACATG AGGAGCGGTATGGCACATGTCCTTAATCTTCGTAT
solcap_snp_c2_1155 PGSC0003DMB000000312 329375 TTGATAATTTCAGGAGGCTCTGTATATATAATCGG GATAACTCTAGCACC[A/G]GCCATTTCAGCAAAC TTGACATAAGAAGCAGCTATGTATGAGACATCACT
solcap_snp_c2_1157 PGSC0003DMB000000312 329207 TTAAGTGCCGGATCAGTCGCCGGACAGCTAGGAAA ATTCAATTGGGACTC[A/G]ATGATCTGGGGTTTC ACATGAGTAGCCATCAATTGGATGAAAATTGTGAA
solcap_snp_c2_1181 PGSC0003DMB000000312 283610 CTAGGACTGCATGTTCATCTAACCAAGCAGCCCTA TCGAAGATTCAATGA[T/C]GAAACATACATCATA CGTCTGGTTAGGTCTCTTTGTCTAAATTTTAGGCA
solcap_snp_c2_1209 PGSC0003DMB000000312 156503 GTTCAAGAAAGAAAGGAAAAAACATAGTATCTCAA GACTCGAACTTGAAA[C/T]AGATTTTCCACAGTA ATAGATCACAAGACATAGTTTTTAAGGAATTTCTA
solcap_snp_c2_1220 PGSC0003DMB000000312 149616 GTTACAAACTGCCAAAGAATGCCCAAGACCCGAAG CTATAGAGAGAGGAA[A/G]GAAGTTTATATCAAC GGGTTGCATTCCCAAGTCTTTTATCGCTCTTCCTA
solcap_snp_c2_1263 PGSC0003DMB000000312 74777 AAAAAGAATGCTGATAACCCACTCCTTGCGACGAC TTTGGACTAGAAGTT[A/G]CCTGATTCAAATGCC CAACCCTTGCAGGATCTTTACCAATGGGTGCAATC
solcap_snp_c2_1296 PGSC0003DMB000000149 1298231 AAGCTGGGCTAAGTTACAAATTCCAGTCCCAGAGT GCCATAAAAATACAT[A/G]ATCATAAGAGCCAAG TAGGTTGTGGAAATCTACTTGTAAAATTCCATGAC
solcap_snp_c2_1305 PGSC0003DMB000000149 843749 ACATCATCATAAGAAGCACTTTTATCTAGCCGGCA AGTCAAGTCAACAAC[A/T]GAGACATTAGGTGTT GGGACACGGAACGCCATTCCAGTGAGCTTTCCATT
solcap_snp_c2_1345 PGSC0003DMB000000149 665214 CCATGAAAATGTCGTTCCCATGCGAAGGCTGCTGA AATCCAAACTGCCTC[G/A]ACTGTCCCCGCCCAT ATCCACCTCGGTTATAGTTTCTGTACTCCGAATTA
solcap_snp_c2_1475 PGSC0003DMB000000149 316087 TCTTGATTCTTACATTAAGTGATGAGAGAGTAGAT ATCGTCTTACATCAA[T/C]GACACTAGAGCTCTC ATCGTAATAGTACAACACAGAACTGAAAGTTCCCT
solcap_snp_c2_1483 PGSC0003DMB000000380 159740 ACCGGCTTAGCTGAGGCGGCAAAGGCAGCTCTTTT TCTCGTGAATCCTTA[T/C]GGTCATATATCCTCT TCTGTGGTGACCCAGAAGAAGTAGGACGTCTACGT
solcap_snp_c2_1484 PGSC0003DMB000000380 158867 GGTATCGTTTGTGTGAGACAGGTTTTCCTTATCTG CTTTGACACTCTCCC[C/A]ATCATATGATTCCTT TAACCTTTTAACTGAATGAGAGTGTCTATGAGTTG
solcap_snp_c2_1485 PGSC0003DMB000000380 158688 TCATCTGACGTTGACTCATATCTGTCAGACCTCTT ATGCTTTCTTTTATC[C/T]TTAATTTTAGCTCTA CGCTTTTCACTTTCCTCGAAACCAGAACCCTCATT
solcap_snp_c2_1486 PGSC0003DMB000000380 158454 CCCTCTTTCCTCAGATGTTCATCATCAGAAGCATG ATTATCAGGATTCCT[C/A]TCTGTATCTGAAGGC GAGGATATGGCATTAGCTGACTTCGATTTTAGTTT
solcap_snp_c2_1493 PGSC0003DMB000000203 128316 TGAGGAGACTGGGCTGACAAGAGAGACATTCTTAA GTATCCAGAATGCTG[T/C]CTCAAAAGTTGGTAG AGAAAAATTGAAGCCCATAAAAACCGAGTTACCAG
solcap_snp_c2_1494 PGSC0003DMB000000203 128007 GGATCCAACCAGTCAAACCCCTGTTCCCAGTAAGA CTGTCACAGTTCCAA[A/G]CAATAAAAAGTTAAC ACCAGCAAAATTTGAAGCATGGAAGATGTGGCATG
solcap_snp_c2_1505 PGSC0003DMB000000471 344902 TGGCTTTTTGGTGATTTAACATGACATTTTCAATG CTTGCAACACTATCC[C/T]TTTTTTCATCTTGTT GCAATCCAAGTAGTTATGCCTTTCTTGATCCGGGA
solcap_snp_c2_1506 PGSC0003DMB000000471 344850 TTTTTCATCTTGTTGCAATCCAAGTAGTTATGCCT TTCTTGATCCGGGAA[T/C]AATTTCCATTGATAG ATACATCACTATCGAGCAGGTTTGTTGTACAACGG
solcap_snp_c2_1508 PGSC0003DMB000000471 323701 ATGAGGAGTACCTTAAGGCTCTGAATGCACTATTT GGAAACTTCCCCCGT[T/C]TAAGGGCTACTGAAC CTGCAACCCTGAGTATTCCACATTTAGTGACATCC
solcap_snp_c2_1511 PGSC0003DMB000000333 55737 CAATTCTCTCCTACAAGTTATTACCTCAGAACAGA ATGAGGATCATCATT[C/T]GAAAGCCTCAACTCC ACTTTCAGATTCTGATGGATACAAGACACCTACCT
solcap_snp_c2_1514 PGSC0003DMB000000333 160545 CAGAAAATGAGGGAACAAATGTCTTTGACACTGGA TTGATTTAAACAAGG[G/A]GACTCCAAGATTTCC ACGAAGATACCAGACTATTGGACTTTGATTGAACA
solcap_snp_c2_1533 PGSC0003DMB000000127 971301 TCGGCCAAGGATTGGAGAGGTGGAAGAGCTGCTTC GTTCAACATTATTCC[T/C]AGCAGTACTGGAGCG GCCAAGGCTGTTGGGAAAGTGCTACCAGCATTGAA
solcap_snp_c2_1536 PGSC0003DMB000000140 552820 TGTGTTGCATCGTTCGATTGGACCTGCAGTGGAAT ATGCAGGTCTGTCGA[C/T]AGGATGAAGGAGGTC CATCGCCATTGTGGCGAGGGAGAGAATGCACTATG
solcap_snp_c2_1542 PGSC0003DMB000000140 524701 ACAAAGGGGAATAACATGTGGAATCAATTGTCAGT ACCAGCTACCTCGCT[C/T]TACTCATGGGAACCT AGTTCTACGTACATTCATGAGCCACCATATTTCAA
solcap_snp_c2_1545 PGSC0003DMB000000127 1022131 CACAAGGTACCCGAACAGGGGACTTTTTGTTGTTC TGGCAAAGGAAATGC[T/C]GAATTCTTGCCATAG CTTCAGCTTCCCTCACAAAGTCGAATTCGTAGCTA
solcap_snp_c2_1556 PGSC0003DMB000000127 1086090 GAGGGCTTTTTCTCCTCCCTTAATGTGCTCAAGCT TCAAGGTCTCAGTCA[G/A]TTTAATGTAGACTCT CTTCCTTTTTTCACCTGGGCGATATCCAACCATCC
solcap_snp_c2_1560 PGSC0003DMB000000127 1095559 TTACCAATGCTACAGGTCCTCTCAAATGTGAATGC ACCTTATTACTATTG[C/T]CCACGGATACTGGAT TAACTGTAATGACTTGAATCCTTTAGTCGTTTTGT
solcap_snp_c2_1567 PGSC0003DMB000000127 1169534 ATACCGAAATCCAATCCGTTTTCGTGTAACGAATC GAATATGGTTTTCTG[C/T]GGATACCCTGTAGCT AGCTGCTTCTTTACATGACTAGTGGAACCATGAGA
solcap_snp_c2_1579 PGSC0003DMB000000127 1203958 CTCTATCTCACACGCACAGAAGCCGCTTCAAAATC TGCAATGGCGACACT[C/A]GGTAGATTATCGAGA AGAGTAATAGCAACAACTCTCTCCGGTCACCTCCG
solcap_snp_c2_1616 PGSC0003DMB000000127 1309250 CCATGATCCGTGTCATCAACAGGCCACTTTTGTAA TCCCAGCTCATTGAT[A/G]TTGTATACTCCATAT GATTGACTCAACAAATTCACAGTTCCGGCATCCGA
solcap_snp_c2_1681 PGSC0003DMB000000127 153487 CAAGAAAAAGCACTGATCGGAGAGAGAAACCAAGA AAAAGCACTGATAAG[C/T]CGGAAAAGTTGAAAA ACTATGAGTACAAGTATGCCAATGATGATAAGCTT
solcap_snp_c2_1688 PGSC0003DMB000000127 184949 CGTGAAGCTCCAAGCAAAGTACGATGATGCTTAAT CTTGGAACCAGCATA[A/G]TGCTGTCTGAATTCA TGGTTAGTCATGTCTGCAAACTTATTCAGTTTCAA
solcap_snp_c2_1714 PGSC0003DMB000000127 254616 ATAACTCTTTCGTTTATTCACTGAGACTTCCTGCT GTTGGTCTCGTCGGA[A/G]AAATTCCTTCTAACA GTTTGGGCCGGCTGAGTCAACTTCGAGTTCTTAGT
solcap_snp_c2_1715 PGSC0003DMB000000127 254756 TTTTCTAACCTTAAGCTTCTTCGTAGTCTCTATCT TCAAAAAAATGAGTT[T/A]TCCGGCGAGTTCCCG GAGAGTATTCCCGGGTTGACCCGGTTAAACAGGCT
solcap_snp_c2_1716 PGSC0003DMB000000127 254816 TTCCCGGAGAGTATTCCCGGGTTGACCCGGTTAAA CAGGCTGGATCTTTC[G/A]TCGAATAACTTCACT GGTACTATCCCTTTCTCTATCAATAATCTGACCCA
solcap_snp_c2_1717 PGSC0003DMB000000127 254870 AATAACTTCACTGGTACTATCCCTTTCTCTATCAA TAATCTGACCCATTT[G/A]ACTGGACTTTTATTG CAGAACAATAGCTTTACTGGTACTCTTCCTAGCAT
solcap_snp_c2_1718 PGSC0003DMB000000127 254947 CTTTACTGGTACTCTTCCTAGCATTAATCCGCCTG GTTTAGTGGATTTCA[G/A]TGTTTCGAATAATCA GCTAAATGGGTCAATTCCTACTGCACTTTCCAAAT
solcap_snp_c2_1719 PGSC0003DMB000000127 255020 GGGTCAATTCCTACTGCACTTTCCAAATTCCCAGC TTCCTCTTTTACTGG[A/T]AACATTGATTTATGT GGCGGCCCATTACTCCCATGTACCCCATTTTTTCC
solcap_snp_c2_1720 PGSC0003DMB000000127 255049 CCCAGCTTCCTCTTTTACTGGAAACATTGATTTAT GTGGCGGCCCATTAC[T/C]CCCATGTACCCCATT TTTTCCTTCTCCTTCACCTTCCCCTGAAACAGAAC
solcap_snp_c2_1721 PGSC0003DMB000000127 255209 ATAATTATAGGTTCAATAATTGGGGTTCTCCTACT CTTGTTACTCCTTTT[C/G]TTCTGTTTAAAACGA AGAAAAAACGACACATCAAAGGTACAAAAACCTCC
solcap_snp_c2_1722 PGSC0003DMB000000127 255260 TTCTGTTTAAAACGAAGAAAAAACGACACATCAAA GGTACAAAAACCTCC[G/A]GTAGCATCAAGAGCT ATCGGGGCAGTAACAGGGGCAGCGGCTGAGGCAGG
solcap_snp_c2_1723 PGSC0003DMB000000127 255311 GTAGCATCAAGAGCTATCGGGGCAGTAACAGGGGC AGCGGCTGAGGCAGG[G/T]ACATCGTCGTCTAAA GACGATTTAACCGGTGGTTCAGGTGAAGGGGAAAG
solcap_snp_c2_1724 PGSC0003DMB000000127 255338 ACAGGGGCAGCGGCTGAGGCAGGTACATCGTCGTC TAAAGACGATTTAAC[A/C]GGTGGTTCAGGTGAA GGGGAAAGGAATAAACTTGTGTTCTTTGATGGGGG
solcap_snp_c2_1725 PGSC0003DMB000000127 255386 ACCTCAGCAGAAGCTCTTAACAAATCTTCAAGATC AAAACTATACCCACC[C/T]CCATCAAAGAACACA AGTTTATTCCTTTCCCCTTCACCTGAACCACCGGT
solcap_snp_c2_1748 PGSC0003DMB000000127 272421 AGGTGTAACCAATGACGGCTCATTAAGCCCCATCC ATTCGAAAAAATACA[A/G]GCAATCAATCGCCAA ACCTTCATTTCCCAGCAAACCCAACACTTCCTCAC
solcap_snp_c2_1813 PGSC0003DMB000000127 377403 GATACTGTAATAGCACTCCTGAACAGCATAGGCCA TGTACTCATCCCTGC[G/A]TATTCTGGTCCACAA ATCTCCTTGTGTATCTTTGCAATCCAAAGCCAAAT
solcap_snp_c2_1830 PGSC0003DMB000000968 28408 AAGTCCTTATTAATGCTTGGGGAATCGGCAGAGAC CCATTATCGTGGGAT[G/A]ATCCGGAGGAGTACA AGCCAGAAAGGTTCTTGAATAGTAATATTGATGTG
solcap_snp_c2_1835 PGSC0003DMB000000127 567919 TAAGTCAAGTAGCGGATTTTCCAGTGAGAATTTAA ACTATAGACCAACTT[C/A]GGCTTGTCTAGTGAT TGTTATATATATTTTCGCCTTTGGCAGTTTTGATA
solcap_snp_c2_1844 PGSC0003DMB000000968 35648 CTCTGGATCATCCCACAACAATGGGTCTCTGCCCA TTGCCCAAGCATTAA[C/T]AAGGCCTTGAGTTTT AGCAGGTATGTCATAGTCTAATAATTTTACGTCTT
solcap_snp_c2_1887 PGSC0003DMB000000127 911148 CATGGGTAAAGGTGGAAAGCGTGACAGACGCGTGG GTGGAAGGGTATGGG[C/T]TAGGACGTACGGATG AGGAAAAACTGATAAATCTGGAGCGGGACAGCTGT
solcap_snp_c2_1898 PGSC0003DMB000000007 1097103 AAAATTTATATGGGTGGTGGATTAGTCCATCTTCT CTTCATCTCTGACTT[A/C]GATCGAACCTCTTTC AGTTTGCCATCTGCTTCATAATCTCTTTCCATAAC
solcap_snp_c2_1903 PGSC0003DMB000000007 349483 GACAAAAAAGAGGCGGAAGAGATCCAAGTGCAGCA GATCAAGTCTTCGGT[G/A]AGCCTTCCATTTCAT CCATTTTCAGGTAGTATTGAGCAGCTACAGAAAGC
solcap_snp_c2_1905 PGSC0003DMB000000007 349109 GGATAACAAAAATATAGTTTTTGCTGAGATGGATG AAGGGGGTGAGAATA[C/T]GCCCCTGTCCATAAA TCAAAAAAGTAAGGGAAAGCTTGCTGAGAAACCAC
solcap_snp_c2_1908 PGSC0003DMB000000023 1070234 TTGGTGCAGAAGAATCCGCTTCCTCCAATCAGAAC CATCCTGCTGAAATA[C/T]GTGGTTCTGAAGCAC ATACTGATGATACTTCGGGGATAGATGACGATTCT
solcap_snp_c2_1914 PGSC0003DMB000000023 1340325 TAATTTATTCCAATCACATCATTCTTTTCATGTTT TTTAGTTGATTGGGG[G/T]AAGGGGTTGAATATT GGGACTGGACTGCCTTCAGTTCTTTAACATACATA
solcap_snp_c2_1915 PGSC0003DMB000000023 1325655 CCAAAACCCTTCCCACACTCCTCTGCACTCTCCTG AAGTTGCAGAGCAAA[C/T]TCAAGGTTCCACAGC ACATCTCCCATCGACGGCCTGTCTACACCAACATC
solcap_snp_c2_1916 PGSC0003DMB000000023 1325394 AGAGCTGGCCGAGCACACAAAATCTCAAACAGCAC TACACCAAATGAGTA[G/C]ACATCAGATTTGTCT GTCAGTTGCTGCCTTCTGAAGTATTCTGGATCCAG
solcap_snp_c2_1917 PGSC0003DMB000000023 1325274 ACTAATATCCTCTTGGATGAAAAGTGGGTGGCAAA GGTTTCTGATTTTGG[G/T]TTGTCTAAAACAGGC CCTACATTGGATCACACCCATGTCAGTACCGTGGT
solcap_snp_c2_1918 PGSC0003DMB000000023 1325124 TAGTGCAACCCACGAGCAGCACCAATGCAAATCTC AAGCCTCTGCTTCCA[T/A]GGTAAAGGAGGCTTC TGGGTCTTATAGAGGTGCTCACGAAGGGTACCATG
solcap_snp_c2_1950 PGSC0003DMB000000091 68375 GACTATCCTGTTATTTTGCTGCGACATTTTTCTTT TCCGTTGTTGCTATA[G/A]AGTTTCCTAAACAAA AATGTCTTTGAACTATTACTTTGTTTCTGGAAGCT
solcap_snp_c2_1962 PGSC0003DMB000000252 601396 AGTGGATCTCTTCTTTCTGCTTGCTCCAGAATCTC AATGCATAACCGATC[T/C]TTTGGAGCAGATTTT CCTTCCTCTGTAGACTTAGTAAAATCCACAAGCCT
solcap_snp_c2_1964 PGSC0003DMB000000252 601648 TTAACATCAGCAAGTGAAAGATCTAAAAGTTCTGC TGTAGTCTTTGCATC[G/A]CAATATGCTACAGCA TAGTGGAGAGCATATGCATCATCGAGAGTAGTATG
solcap_snp_c2_1967 PGSC0003DMB000000252 611050 GCTCCTTGAGTTCCAGCTTCGTCTTCCTATCTTTC CCACAGAATACATTC[T/C]TAAAAAAAGGACTCC TCGCTGACAAAATGCATCGGTGCACCGGAATTTCC
solcap_snp_c2_1968 PGSC0003DMB000000252 611151 TTACCGCCTGGAACCACAAGCTTAGCGTCAGCGAA GAAGTCGAAATCCGG[T/C]GAAGACGCATCGAAG ATAGACTCTAGTGTTTCTGATAGACGTTTGAGGGA
solcap_snp_c2_1974 PGSC0003DMB000000252 723943 AGATATGCCTCATCTAGCAAGAATACTTCTGGTAT AAAGAACTATGAATC[A/G]GCACTCAAAGGAATT GAGACTCTACATTTTGATGATGAAGAGAGGGCTCA
solcap_snp_c2_1975 PGSC0003DMB000000252 724143 ATTGACAGCACCTCACCTCCTGCATTTGCACCATC TGGATCTATTTATTT[T/G]CTGTAGATCTTTTGC CAGAGCGAATAACAACTGCTCATTCACTAGTTTCC
solcap_snp_c2_1980 PGSC0003DMB000000252 730035 CTGTAACCGTTACCAAAATCAGTAGAATAACTGTA GCTTTCGACTTGTCC[T/C]CTGGAATCGTTATAT GACTTGCATCTCAAGTCATCCATTTTTGGATCTTC
solcap_snp_c2_1991 PGSC0003DMB000000252 852996 GGTTTTCCTTAACCATAACATCTCACTGACAACTT TCTTTGCAGGCAATT[T/C]TTTCCTGTCTTGACT GATTCATCTAACAATGTCCCAAAGTTAAATAAGCT
solcap_snp_c2_1993 PGSC0003DMB000000252 876465 ATGGCGGCGACGATGAGGTCCGGATAGGAATTATG GTCCGGGTTCGGGGC[G/A]AATGCAGTCCGGAAG ACCGTTCGACATTGAGATTCTCTCTCGAGTATAAT
solcap_snp_c2_2000 PGSC0003DMB000000037 104109 ACAAATGATTTATTTTCAGCTTCTGCAACCTTATA GGCAGCAGTGATTGC[T/G]GCTTCTTCGGCAGTG TCACCAAGATAGGCATTATTTGGAAACTGCCTTGG
solcap_snp_c2_2002 PGSC0003DMB000000037 104538 TTAGTTTATGTACTAGGGATGATGACCTTTGCACA AATTCTCACCTCCTA[T/C]TATGTATTCAAAGTA ACAAAAAAATAGAGGGAGAGAAATTTTTTTAAAGC
solcap_snp_c2_2031 PGSC0003DMB000000037 377332 GGATATAGCAGAAAGGAACATATCCTTATACAATG GCTCCCTGAAGCAGC[T/C]TTTTCCTGTCTCCTC GAATTCTATGCATCGATCCAAAATTCGCTTGACCA
solcap_snp_c2_2074 PGSC0003DMB000000037 775810 GGAGAGCGCAACGGAAACCAACAACACTTCTGAAA CAGTTCATTCTGAAT[A/G]ATGGAACTATCTGAT TTGGAGTGTTCATCATCTGACTTAGCTGTTGTTAA
solcap_snp_c2_2105 PGSC0003DMB000000045 570442 AGGGGTGTGAATATCTCCATGACTAGAAAATCGTA GACATGACTGATTCT[T/C]TCTTCTGCTTTGCTT GCTCAGTGAAGATTTAATTGGGGCAGACTCGTGGA
solcap_snp_c2_2122 PGSC0003DMB000000045 1290201 GGGATCAAGGATAGTTTTGATGATAGCTTCTCCGA TATGAAGATGAAGAT[A/G]AAGCAAAAACGATGT TTTGAAGAGTCCTTTGAGGATAAAGGAGTAGTTGA
solcap_snp_c2_2132 PGSC0003DMB000000093 161271 CCAGCGATTTACTATTTGTTTTTCGTAGTCTATGT GTTGATGGGGTCTTT[T/C]TGGGTTTTTGCACTT TACAAGAAAAGGTTATCTGTTTATGGAATTCATTT
solcap_snp_c2_2137 PGSC0003DMB000000093 192052 TGCCTAGAGGATCATAAATATACCAAACTTAAACT ACATCAACATACGAA[T/C]TCATAAACCAGCCAG CCAACAGTGCAAGCTTAAGAACAAGGTCAGAGATG
solcap_snp_c2_2138 PGSC0003DMB000000093 192064 CATAAATATACCAAACTTAAACTACATCAACATAC GAATTCATAAACCAG[C/A]CAGCCAACAGTGCAA GCTTAAGAACAAGGTCAGAGATGCCCGGCTGAGTA
solcap_snp_c2_2170 PGSC0003DMB000000188 160750 CCATGTTGGGAAATAGATATCATTTCCCATTTCTA ATAACATGATGAAGT[A/C]TTATGACTATCCTAA ATCTTTGTTAATAAATAAAACTACTTGGTGTGATA
solcap_snp_c2_2170 PGSC0003DMB000000357 624707 CCATGTTGGGAAATAGATATCATTTCCCATTTCTA ATAACATGATGAAGT[A/C]TTATGACTATCCTAA ATCTTTGTTAATAAATAAAACTACTTGGTGTGATA
solcap_snp_c2_2178 PGSC0003DMB000000045 129079 GTGAATGTTAGTCAAGCTAACCGTGTAATATCTGA TAATCGTTGCCTTGA[T/C]ATTGGACCATCTTAT TCTGGGTTTCGTGTTAATAAAAATTCATACTAGTA
solcap_snp_c2_2179 PGSC0003DMB000000045 130700 GTGCCCATTCTGGTTGGGGCTCTTAGTGCTGAAAG TGAAGCCCTTTATGG[A/G]CGGTTACTCGCAAAA TATGTGGATGACTCAAAGAATTTCTTCTCAGTGTC
solcap_snp_c2_2183 PGSC0003DMB000000188 527103 GTCTGGAACACTCCCTTGCAGCAACTGCCATCTCA CGAGCATCAATCTCT[T/C]CAATTGAGGCCCATT TATTGGCATCACAATGAAAGAGGGTGCCGATACGT
solcap_snp_c2_2186 PGSC0003DMB000000060 796707 CCGTCAGAATCCCCAGCGGAATCTCAGTCACAGTC CCCGGCAGAATCTCC[G/A]TCAATATCTCCACCA GAATCTCCGGCAGCAGATACAGATGAATATAAGGC
solcap_snp_c2_2201 PGSC0003DMB000000060 882668 AGAAAGAATAGTTCTGGAAATGGGAAATATGATGG TAGAGATGCTGTTGA[A/G]GCTATGGCTAAAGAA GCCAAGAGAAATGACTTGATATTAAGGTCTTCAGG
solcap_snp_c2_2291 PGSC0003DMB000000363 155138 GATAGATCTCATGACAAATTGCCTCCGTTGTCTCC TATATCAGGAATGCC[G/A]CTATATGAAAATTCT ACGCCATTTCCACCAATTCCAGCAAGCAGGCATTG
solcap_snp_c2_2299 PGSC0003DMB000000060 1336144 TCATCTGTTTCAACTTCACCACTTCCATATGACAC CATCACTAGTCAATG[C/T]GAATCTCTTGGCACA GACTCGAGAAAGAAACTCTCTAATTGGTTAGCTCA
solcap_snp_c2_2307 PGSC0003DMB000000363 149008 TGTGCCCTGATCTGTTGATCTTCACCAATCAAGCT CGCCAGGTAGTTCAA[A/G]CTCTGCACTCTACTA ACACAGGGAGAACCCAAATTCGGATCGAACCCCAA
solcap_snp_c2_2322 PGSC0003DMB000000363 289203 CATATCTCCTAGAGGAATATCATTGGAGAGTCTCT CCGCGATTTATCAAC[T/G]TTCAATTTCATGGTG TTAGCTTATTTATTCAGTCTCAAATTACCGAAGGG
solcap_snp_c2_2332 PGSC0003DMB000000805 19209 ACTTCTGATGCTACAACATTACACTTATGGTCTGC AAGAACAGCAAAGAT[C/T]TCTGAAAGCAATCCT GGTCTGTCTCGCCCCGTCAGTTCAATGGTTGTGTG
solcap_snp_c2_2333 PGSC0003DMB000000805 18882 TCTGGACATCTCAAAGTCACAACGGTATACCCTTT ATCTGCACACCTTTC[T/C]ACAGTTACCAGAGGC TTCCTATTGTCAACCGATACACAGTCTGTATCATC
solcap_snp_c2_2334 PGSC0003DMB000000805 18858 GCATCGAAGAGCAGCTTAGGACGGTCTGGACATCT CAAAGTCACAACGGT[A/G]TACCCTTTATCTGCA CACCTTTCTACAGTTACCAGAGGCTTCCTATTGTC
solcap_snp_c2_2354 PGSC0003DMB000000060 1574491 CTTGACCTGGCTAAAAAGGCAGTCGATTCAGCTGA GAAAAGGCTACGAGT[A/G]GATCAGTGGCCTGAA TATTATGATACCAGGTATGGTAAATTTACAGGAAA
solcap_snp_c2_2384 PGSC0003DMB000000277 875956 TAATAACTCAAGATGAGTATAGTGTTTCAAAGTTT CCAGCTCCTGTAAAT[G/T]CTGTCTCGAGTGAAA AGTTCAAAGAAGCCCAAGCGAAGACGAGGTACAAA
solcap_snp_c2_2400 PGSC0003DMB000000060 64016 CCTCTGCTGGATGGTTCTGCACGCCAATGGCTTTG GAACAACACACAGCC[C/T]ATTACAAAGCTGTAA TTTCTTTATACATGCTGTCAATAATACGTTATTCT
solcap_snp_c2_2420 PGSC0003DMB000000060 96751 ACATCAGTAAAGTCCAAAACATTTTTTTTCATCAA CACAACTGTTCCTTT[G/C]ACCTTTTTCCCATCA TCTTTTCCAGTAATGGCATCCACAATCTTATTCAA
solcap_snp_c2_2421 PGSC0003DMB000000060 101511 AGCAAGCCAGCATACTTGGAGAATTGGATTACAAA CATCACTCCAGTAGT[C/A]GCAGGGGAATCAACT TTTAGTGTTACATTTGAGTGGGATGATGAGGAGTT
solcap_snp_c2_2423 PGSC0003DMB000000060 102423 GAGGTGTCGGGTACTTGAGTAGGCCTTCACCATCA GTAGAAAGGAGTTGT[T/C]TTAGTATCTCCAAAG GAATAGCATCAACAATGGCTTTAAACGAAGTCCCT
solcap_snp_c2_2424 PGSC0003DMB000000060 103862 CAGGCTTGGAGTTCAGTGTCTTTCTGTACCGCGTC ATCTGATTTGTAATA[G/A]TAGTTGCAATATTCT GTTACCCAACTTTTGATTGCTGACCAAATTTCCAA
solcap_snp_c2_2425 PGSC0003DMB000000060 103928 TGCATTTTAGGCCACCAAGGCTCATCTTTCTTGTC GCCATGTCCTTCTTC[G/A]CGGAGCTCCTTCCAC CAGGCTTGGAGTTCAGTGTCTTTCTGTACCGCGTC
solcap_snp_c2_2426 PGSC0003DMB000000060 104042 GGCCGATTAGGGAGATAACCAGCATAAGGGTATTG CCCAAAATTAACTGC[T/C]GCATGAAGTGCTGAA GCTATCCATATAGTGATGGTGCAGGAATCTATGAG
solcap_snp_c2_2427 PGSC0003DMB000000060 104090 TCATACTCTGCACTTCCTGGCTCTGGCATGAATTT CCGGCTTAATGTAGG[C/G]CGATTAGGGAGATAA CCAGCATAAGGGTATTGCCCAAAATTAACTGCTGC
solcap_snp_c2_2428 PGSC0003DMB000000060 104345 CTGTTCTTCCATTTCTCAGGATCACCATTCATCTG CATAATTCGATCCTC[A/G]ATATCACTCAACTTC TTTCCAAACCTCTCAAAAGCTGAAAGTGGCTCTTG
solcap_snp_c2_2450 PGSC0003DMB000000060 199833 ATCTACATCAATCTCATATCACCAAATATTCAGAC AGTCAGTTGCAGCTG[C/T]TTTTCCCAACAGTTG TGCCCAGCATATGTTTCATATGCTGCTGCAGAGTG
solcap_snp_c2_2463 PGSC0003DMB000000060 334609 AGATAAGGTAAATCCCTGATTTTGTGAGAGACGAT TCATCGAGAGTGAAT[T/C]TCATGGAGTGATTCC ACTTAGGATTCGTGCCGCTATTCTTATCAACAAAA
solcap_snp_c2_2464 PGSC0003DMB000000060 334637 CCCAAAGTGCGATCAGATTTGAGACGAAAGATAAG GTAAATCCCTGATTT[T/C]GTGAGAGACGATTCA TCGAGAGTGAATTTCATGGAGTGATTCCACTTAGG
solcap_snp_c2_2465 PGSC0003DMB000000060 335186 GCAGGATTGCTTGGTGGTTTGTTGGTGGGAGATAT GATATCTGACGTCGG[A/T]GAGATGTCTTCTTAT GGTGATGGGTATGGAGATGCTATGGATGATATGGG
solcap_snp_c2_2466 PGSC0003DMB000000060 335196 TTGGTGGTTTGTTGGTGGGAGATATGATATCTGAC GTCGGAGAGATGTCT[T/G]CTTATGGTGATGGGT ATGGAGATGCTATGGATGATATGGGTGGTGGCTTT
solcap_snp_c2_2505 PGSC0003DMB000000060 494723 TTATGATTTTAAATATCTCTGTCCTTAGTGCACTC TGGTGGCGGAACAGG[G/A]TACCTCGCTTTATCA GTGCAATAGTTATAAACAGTGTATTTTTGACGGAC
solcap_snp_c2_2506 PGSC0003DMB000000060 494915 TCTTGTGGCGTGGCAGCTTCACATCCGTCCACGTG GAACGATGTGTATGA[C/T]GCGGTAAATGGGGCA TTGGACCAATCGGTTTTCTCAAGCCCACCTCTTGT
solcap_snp_c2_2507 PGSC0003DMB000000060 494981 TTGGACCAATCGGTTTTCTCAAGCCCACCTCTTGT GGCCCAATCATCTGC[G/A]TCCCAAAGACTTGAG TATATCTTCATTGGCTGATTGAATGGGAATTTCAC
solcap_snp_c2_2508 PGSC0003DMB000000060 496996 AACTTAATGTGGTGACTAGCCCAACTTGGCTCATA GTTTTTCCAAAAGGG[C/T]ACATCTACTGGCCTT CTAGGATACCCACAAAATCCAACAAGTGACAAATT
solcap_snp_c2_2509 PGSC0003DMB000000363 229038 ACATACTCTTCTTCATGCCCTGCCAATTCCTTCAG ATCATATAACCAGAC[T/C]GTGAGTCCAAGGTCT TAGGAGGAGCCAGTAATTCGGAATCTGAAGACGTT
solcap_snp_c2_2540 PGSC0003DMB000000751 142094 ATCAAAACCCTTGTTTCTTCTTCTCCTCAATTGTT GTTTTGTCGTGTTGA[T/C]GAAAACCTCAAACCC AAGATTAAGGTTTTACAAGGACTTGGCTTATCTGT
solcap_snp_c2_2551 PGSC0003DMB000000060 632011 CAAGGCCTCAGAGAGTTGAATCAAATAGGCAAAAT TGCTAATCAATAGAA[G/A]AGAACACTTTCAATT CAATCAGAGGGTCATTTGCTGTCCCACATAATAAG
solcap_snp_c2_2571 PGSC0003DMB000000060 739935 TGCATGCATGGTGGGATTTCGCCAGAGCTAAAAAG TTTGGACCTAATAAA[C/T]GAAATTGAGCGGCCA GCTGAGATTCCAGATGGTGGCTTGTTGTGTGATCT
solcap_snp_c2_2582 PGSC0003DMB000000035 447925 GACACTGGTGAGCTGATGCGGTATAAGAATGAGTT GGGGGAAAGTGGAAC[T/C]GTTGGTCGAACAACA CAAAAGCGAAAAAGACCTTACGGTAGAAAGTTGGA
solcap_snp_c2_2591 PGSC0003DMB000000035 533252 TCATCCTCAGACTTGCGTCCTGAAGTCATATCTGG ATCTGGCAGGGATGG[G/T]TTCTCTACCCAAGTA TCTTCCATGAACACTTCAAGCGGTTCAGTTGGTTC
solcap_snp_c2_2649 PGSC0003DMB000000035 771774 TGAAGACAAAGTTTGATTGTATATAGAATTTTGTG AAGTGGGTTTTGTTT[G/A]ATTTGTGTAGATTTG ATATGGGTGGGTGTTTTCCTTGCTTTGGATCATCA
solcap_snp_c2_2653 PGSC0003DMB000000035 780941 CCTGTTATCAGCTCAAGGAAGACAACCCCAAAACT GTACACATCAGATTT[C/T]AATGTGAGTTGACCT GTCATTGCATATTCAGGAGCACAGTAACCATATGT
solcap_snp_c2_2721 PGSC0003DMB000000035 1321215 ACGCTGCTGTTCAAAACCGTTTGCATCTTGTTTTC AAGCTCCGATGTCAA[A/C]GGGCGCTTGGAGATA AAGATATTGGACAAGTTGATGTACCCATCAAAGAG
solcap_snp_c2_2729 PGSC0003DMB000000643 3242 TGTCAAAATATGCTCCGCTCATCCATGTTATGAAG GTTAAACCAGAAAAA[G/A]TAAACCTTATAATTG GCGCCGGTGGAAAGAAGGTGAAGAGCATTATTGAA
solcap_snp_c2_2739 PGSC0003DMB000000643 1281 CAACTGAAGCTCTTAAGGAGAATTGCGTAGAATTT CGTCTTCGGCTTCTG[T/G]TCCTCCTGTTTTCCA GTGTTGAGGAAGCAAAAAACTGATAGGTTGTGCTG
solcap_snp_c2_2743 PGSC0003DMB000000198 111948 TTTGCTTCAACTTTTTGGAAACAGGTTCCTCATCA AGGTCAACACCTGCA[A/G]CTTTTCTCTTCTCTG GGAATTTCAGCCGCATATGTTTAGGTTCTAGCTTG
solcap_snp_c2_2744 PGSC0003DMB000000198 112464 TTCTTGTCGTTTTCAGGACAAATCCAACAACATCA CTACATTCTGTGTCC[G/A]GTGAATTAGGAAGAT CCTCAGCTTGGTCTGCAAGTCCTGCTTGATTCACA
solcap_snp_c2_2745 PGSC0003DMB000000198 112488 GACCCAAGTGGTAAGCACCATGATTTCTTGTCGTT TTCAGGACAAATCCA[A/G]CAACATCACTACATT CTGTGTCCGGTGAATTAGGAAGATCCTCAGCTTGG
solcap_snp_c2_2746 PGSC0003DMB000000198 113416 TCTTGAGCAGCCATGTTCCAGAGATCACTTGGGAT TTCCTTAGACTCTGC[G/A]TCAGAGATAGATAGC ATTTTTGAACCTTTCATCTGGTTAGAAAATTGATT
solcap_snp_c2_2747 PGSC0003DMB000000198 115762 GCTTTAGCATAAGGAAGTATATACTGAAAAACATC AGCACATTGTTCCTT[T/G]GTTTGGTAATCACCC CGGCTTGTGTTCTTATGCTCACCTAAATCATCTTC
solcap_snp_c2_2748 PGSC0003DMB000000198 127981 GCCAAATAAATAAAGATCAGGGGTTGTGGGATATG AAACGTACAGCACTA[A/C]TACTCCAATCCAGAT GGGGAACAATGTTTTGCAACCTAGACTTTTGTGTA
solcap_snp_c2_2753 PGSC0003DMB000000198 151460 CAAAAGTCCAAATTGAGTATAGCTGTCGGTTGTTG CTTGGAACGACGCCA[A/G]ATCTACGCGGATACC ATAGATCCTTAAAGCAGGATTGGCAAAAGTCTCGA
solcap_snp_c2_2754 PGSC0003DMB000000198 151479 TAGCTGTCGGTTGTTGCTTGGAACGACGCCAAATC TACGCGGATACCATA[G/A]ATCCTTAAAGCAGGA TTGGCAAAAGTCTCGAGCCATCTTAGCACTGGGCG
solcap_snp_c2_2757 PGSC0003DMB000000198 152786 ATTCTACGCCGCCATTGCTGCCATGACCATGCAAG AGGATACACAAGGAT[G/A]CAAAGAATGCTATGC ACTGCTCCTTCCCACCATTGGTAGGCAGCAATAGT
solcap_snp_c2_2780 PGSC0003DMB000000643 165646 AAGGAGAAAAATGAGGTTTCAGTTCGGTTTTAGGT TTGGCCGATTCAAAC[T/C]CAAAAACATGTTCAG GGAATCGGAGGATAGCATTGAAGCAGTCACAATTA
solcap_snp_c2_2783 PGSC0003DMB000000643 164016 CCGGCGAGGGTAGGTGAGGGTAGAGCCTTATAGTA TACATTGACGAGGGA[C/T]GAAGGAGAAGCTTTG AATGTAAGTTGGTTGCCGCAGGTTGATTTGAGGTG
solcap_snp_c2_2826 PGSC0003DMB000000070 1515904 GTTAAGGGTCATGTTTAAGCATTGTGCCTAGAATA TATGGTAGGTAGCTA[A/G]GACAATGTTAAACCA GAGGAGAATGTGACTCCAGCCAGGTTTGAGCCTTT
solcap_snp_c2_2837 PGSC0003DMB000000070 1359190 GCTATCACCTTCCTTCCTTTCAGTATAATATACCC GTTTCATCGAGTAAA[G/A]GTGGAAGTTGATTGA AGAAGAAAAATGGGTTGGGGGAAAATGTTCTTCAC
solcap_snp_c2_2840 PGSC0003DMB000000070 1057581 GCGGTTTGACGTCGGACGATGACTGTTCCGGTAAA CTAGTTCTCAAAATT[G/T]GTGAATTTTCATCCG GCATATCCATTTCTTGTGACAATGAACAATTTTAT
solcap_snp_c2_2842 PGSC0003DMB000000070 1057451 TGTAAAATCGACCTTGATAACCACTGGTTTGAGTT GGACTGCAAATTCTC[T/C]CCAGCGCCGGCAACA GTATATTGACTTTGTGGTAAAAGTATTTCTCTGTT
solcap_snp_c2_2850 PGSC0003DMB000000070 839372 CGACGACGATAGAGTCTTAAGTTTGTGTTTTGCTC CCGGCTCGTGAAAGC[C/T]TCCCTTATTTTTTCA AGGGGAAGGACGAGTTGGTCAAGCAATTTATCATA
solcap_snp_c2_2855 PGSC0003DMB000000318 419850 CCCACATCCTCAGACTTAAAGCTCCTGCAAGGTTG TACAACAACTCTACG[T/C]CGTCCAATCAAAGGC CGGAAAACATTACCGGTCGGTAGAAGGCGGTGGCA
solcap_snp_c2_2856 PGSC0003DMB000000318 424343 TTCTCAGTGTACATCTCCATCGCATCTGTGAATGA AAAACGTGTCCGACT[T/C]TCAGCCCAGTTACGG AGTCGATCCGCCTCTGCAGCATACAGTGCTCTTCC
solcap_snp_c2_2858 PGSC0003DMB000000318 424511 TAAAGCTGGAGTGATGTAAGTTAGCTGTGTCATAA TTCAGTGCTTCCTAT[C/T]TTCCAAACCACCTCA ACCAATTGAGGCTAGCATCTAAGTCCACTCTATGT
solcap_snp_c2_2868 PGSC0003DMB000000318 63343 TGCTCTCATTCGTAGCTGCTGGCCAGAGCTTGCTG CTCCTCTCGCTGGCT[G/A]GTGCTGCTGCCTTCG CTGGAAAAAGGAGAGAACGAAGGGGAAGGAGAAGT
solcap_snp_c2_2871 PGSC0003DMB000000218 1018814 TTTGCTGGCCCAAAGGCAACAAATGGCAGGATGTT CAAGGTTGGGGTGAA[A/G]CTTTTGGTGAAATCT TATGTTTTTCTGCATTCTGGTTGGGTGTGTCCATC
solcap_snp_c2_2873 PGSC0003DMB000000218 1018613 GGATACCTCATGCATTGTAATTGAACAGCCTGATG TTTTTGAAGTCTCTC[T/C]AGATGAGCACAAAGA TAATTCAATGACAACTGGTTCTGGCTGCTCTGAAG
solcap_snp_c2_2874 PGSC0003DMB000000218 1018539 TCATGCTCTTCAGGACAGCCCCAAACTAGACAGCT CCCTTTAACTGATCC[G/A]CGAGTTGATGAAGCA ATAGATGAGGATACCTCATGCATTGTAATTGAACA
solcap_snp_c2_2896 PGSC0003DMB000000131 1277828 GAGAAACTTGATAGAGTTCTCAAAAGACACGATGC ACTTCTTTCTGTTAG[A/G]CCAACCTCTACTTCA AATCCACATGATCATGGCCAGTCAGAAGAAGAAGA
solcap_snp_c2_2916 PGSC0003DMB000000122 1376953 CCGGATGAACTTTTCTCTTCGTTGTGCTTGGATGG GGCGGATCCGGCAAT[G/A]GTCCATGCCGGATTA TTGCAACTTTTTCAATCAGTTTACAGCGACAATTT
solcap_snp_c2_2927 PGSC0003DMB000000122 1372220 TGCAAGTTCTACACAAGATTCATGCTTTTGGGCTC AGGTTGAGGAGGCAA[G/T]AGACAGTCTTATTAA GGTAAGAGCTGAAAGCGATGCAAGAAAGTTTATCA
solcap_snp_c2_2943 PGSC0003DMB000000122 1344247 TCATCTCTCCACTGTTCCTCTTTAGCACTTTTGCC AGAACGAGCTAGTGT[T/C]CCCTCATCCTCTCCT AGCACAACTTTGCGGGCCTTTAATTTATTTAGGTA
solcap_snp_c2_2946 PGSC0003DMB000000122 1343889 CTGATCAGCTGTCATTGCTTCAGTAGTCTCTGGAT TATTAAGATCAATCA[C/A]TTCCTGTCTTGCAAG CCAATCCCAATATTTTGGTTCTTTTGAGAAGTCCC
solcap_snp_c2_2957 PGSC0003DMB000000399 537821 TCCCTCCTTTTGCCTTCCATTCACAATCTGGAGGA GTCCCACAGCACATT[G/A]AACGTTCATCCACAT GTTCCACTTCCAGCCCAATTAACCACGATCCCAAT
solcap_snp_c2_2960 PGSC0003DMB000000688 141742 CTTTTCTCTAAACAAGATCAAAATTGAATCTTTAT CAACAAACCCCACCA[A/C]CAGATCTACCCAGAA AAATCACAGATCTTGGCTAATTCTCACACACACAC
solcap_snp_c2_2968 PGSC0003DMB000000462 269038 GATTTGGGGAAAAATAGTATATACATGTCATTACT TGTAATGTAAACCTG[A/G]AAGGCTTTATTATAT GTACATAATGAATTTGTGCATAGTTACTTGATAAA
solcap_snp_c2_2977 PGSC0003DMB000000319 732335 ATGGCTGGGAAAATCAGACACGAAAAGTTGGCCCA AAAGAAAGCATTACA[T/G]TAAGTATGCACCTAA GGCTAAGTGGTCAAAAATGCAGACAGGAGGTCGGG
solcap_snp_c2_2992 PGSC0003DMB000000688 44157 GCGGTTCGCTATCTACATGAGGAATGGGATGAACA GGTGATACACAGATG[C/T]ATCACATCATCTGCC ATCATTCTTGATCCAGATATGAACCCAAGGCTTGG
solcap_snp_c2_2998 PGSC0003DMB000000319 639654 CTCTGCAAGAATCTCCATGGAAGTAGCTTAAGTAT AAGAAAGCAGAAAAA[A/G]AAGTGAAAGATTTGA TTGTTTGTGAGTTTCTGACAAATGGGGAAGTACAT
solcap_snp_c2_3007 PGSC0003DMB000000319 622137 TCATCAACAGCCATTGCTGATGCCGGGGCTTGTTG TCCAGTTGATCCACC[G/A]CCAGTGCTGGATGCA GTTGATGAGGGTGCATCGGTGAGGGACAGTACTTC
solcap_snp_c2_3010 PGSC0003DMB000000319 621048 CCAACACGGGAATCACTGGCTTCACTTATCTGGAC CATCACCATGGCCAT[T/C]GCTATGAGAGCACCT TGGCGTACAAAATCAACTACATCTGACGTCAAAGG
solcap_snp_c2_3011 PGSC0003DMB000000319 621006 ATGGCCATTGCTATGAGAGCACCTTGGCGTACAAA ATCAACTACATCTGA[C/T]GTCAAAGGTTCCAAC AATGAGATGGCCTCACTCAGACCAGTACCTGCACA
solcap_snp_c2_3021 PGSC0003DMB000000319 532935 CTTAGTTTATCTGCTAATGACAAGGAATACAAACA CCATAGGCTTATGTT[G/A]AGTTTTGTTCAACCT GAATACAATCTTAAGGACTGTTCTCTTGGTTCTTT
solcap_snp_c2_3042 PGSC0003DMB000000319 483461 GGTGAAATGCTTGTTGGACCATCAAAGGCGCTTTT CATGGATGAAATATC[G/A]ACTGGATTGGACAGT TCCACAACATATTCCATTGTGAATTCCCTAAGGCA
solcap_snp_c2_3052 PGSC0003DMB000000319 399486 TGGAATTACAACAGTGCATCTCGTATCAAGCGTGC CATCACACGAGAAGT[G/A]AGTCGACTAAGAATC TCGGGAAGAACCTTAGCCGAGAGGCCTGGAAGCAC
solcap_snp_c2_3063 PGSC0003DMB000000319 325675 AATGCTGATAATGTCGGTTCTAGTCAAATGCAAGG GATTCGTAAGGGTCT[C/T]CGAGGTGACTCTGTC GTACTTATGGGGAAAAATACTATGATGAAAAGGTC
solcap_snp_c2_3066 PGSC0003DMB000000319 309036 GAGGTTGGGCTTACGTTCCACTTACTCAAGGATGT TCCTGGGCTAATCTC[A/G]AAAAACATCGAAAAG AGCCTTCTAGAAGCATTCCAACCTCTAGGTATATC
solcap_snp_c2_3067 PGSC0003DMB000000319 309000 CCCGATAGCGAAGGTGCTATCGATGGACATCTCCG TGAGGTTGGGCTTAC[G/A]TTCCACTTACTCAAG GATGTTCCTGGGCTAATCTCAAAAAACATCGAAAA
solcap_snp_c2_3068 PGSC0003DMB000000319 308920 CTATCATTATGGGTTCGGACCCAATTATAGGGGTT GAAAGGCCTTTATTC[G/A]AACTCGTCTCAGCAG CTCAAACTCTTGTCCCCGATAGCGAAGGTGCTATC
solcap_snp_c2_3069 PGSC0003DMB000000319 308659 GTGTGGACATGCCCGGGTGCGACTACCAACTCGCT AAGCTCCTCGGGCTT[C/T]GCCCATCAGTCAAGC GACTCATGATGTACCAACAAGGTTGCTTTGCCGGG
solcap_snp_c2_3070 PGSC0003DMB000000319 308535 GCAAGGCAAGACATAGTTGTTGTTGAAGTGCCTAA ACTTGGCAAAGAGGC[T/G]GCCCAAAAGGCCATA AAAGAATGGGGCCAGCCCAAATCCAAGATTACTCA
solcap_snp_c2_3073 PGSC0003DMB000000688 84673 GTGACTTTGGAAGCAGAAGTTACGAATAAAGGAGC ACTCGCTTTGTATGG[T/C]CGTCTTGGATTTATT AGAGCAAAGAGACTTTTTCGTTATTATTTGAATGG
solcap_snp_c2_3079 PGSC0003DMB000000319 190752 TCGTCACGATTATCAGTGACAACATAGTAACGACC ATCACGACCACCAAT[A/G]GCATTGCGCCCAAAT CCAATGCCACAATCAGCAAGACGCTTGCGGTTCTT
solcap_snp_c2_3084 PGSC0003DMB000000688 117332 TACAAATAACACAAAACGCTCCACTAATGACATCG ATATCACATTTACCC[T/C]GTCTTTGCCATTGCA TAAATTCTACGCACAAGGTGCATTACAACTTTCTA
solcap_snp_c2_3091 PGSC0003DMB000000266 548518 CTAACAAACTTAGATCAGATAAGAAATTTACCTCG TCCAACTGATGTTCC[C/A]GATTCTGGGTTGCTG TGTGATTTACTTTGGTCAGATCCTAGCCGGGAAGT
solcap_snp_c2_3092 PGSC0003DMB000000266 548710 GAAAACTTCTTTCTCTTGAGAGGAAATCATGAATG TGCTTCTATTAATCG[A/G]ATTTATGGTTTCTAT GATGAATGTAAGCGCCGATTCAACGTGAAGCTATG
solcap_snp_c2_3104 PGSC0003DMB000000266 574180 GCAGTTGGTGCACTCCTTGTTTATGACATAACAAA GGGACAAACATTCGA[C/A]AATGTTCAAAGGTGG CTCCGAGAATTGAGAGAGCATGCAGATTCTAACAT
solcap_snp_c2_3107 PGSC0003DMB000000266 642927 CTGTACATCATTGCCTTTTTACTTTCCCTTGGCCC AAACACAGATACGAT[C/T]ACCTTGGTGTTTCCA AACTCTGCATATGCTGATCCTGCAGCTGTACTCAC
solcap_snp_c2_3108 PGSC0003DMB000000266 750883 AGTAACATATTTTTGCACTCTTCTGATTTGATATA ATTTTCCGAACTCAA[A/C]TCAGCAGCACCCTTA TACAAATTATCTATACATCCAAGTCTTGAGTTACC
solcap_snp_c2_3109 PGSC0003DMB000000266 750961 ATACATCCAAGTCTTGAGTTACCACCTAGCTGCTT TACTACAGCCCCTAA[C/A]GGGAATACAAGGAAA CTGAAAAGGAAGTCTACAAGCTTGACCCCGGCTTC
solcap_snp_c2_3127 PGSC0003DMB000000266 901932 CCAAAGTGTAGGGTATCCTTGCTCAAAGTCCACAT CTTGGCGAACATATT[T/C]TAGTGTACAACAAGT GTATCGTCAGGTCCTTTAGAATTGCAAATGAAATC
solcap_snp_c2_3133 PGSC0003DMB000000052 1221073 TCACGGACACGTGATGCTCCCATTCCAACATACAA TTCTACAAACTCGCT[T/G]GCAGAACAACTGATA AAAGGAACCTCAGCTTCCCCAGCAACGGCCTTTGC
solcap_snp_c2_3134 PGSC0003DMB000000052 1221076 AGGTCACGGACACGTGATGCTCCCATTCCAACATA CAATTCTACAAACTC[G/A]CTTGCAGAACAACTG ATAAAAGGAACCTCAGCTTCCCCAGCAACGGCCTT
solcap_snp_c2_3135 PGSC0003DMB000000052 1225332 AGAGCACAGATGAAGGCGTGGAAGTCCTTACTCGA AATTCATTTTTGTAC[C/T]GTTGACTGTGTTAAG CTTGCACTTTCTGTCATCCAGAGCCTGCTTGCAGT
solcap_snp_c2_3145 PGSC0003DMB000000337 415409 TTCTCTAAGTGTAGTTATCCGCTTCTCCATTTTTT CAGCCCAAGATAATC[G/A]TTCCTTGTGTACAGA CAAAGCTTCACCAAAGCATCCAGATTGCACCATTC
solcap_snp_c2_3146 PGSC0003DMB000000596 272744 AAACAACTGTACAATCAGTCAGCTGATACTGCAAA TGTGCAGAGGTTCTT[A/C]ATCAGCCTCAACTAC TTATCAAGCTTTGATAAAACATAAAGGCAAAAAAC
solcap_snp_c2_3152 PGSC0003DMB000000596 74647 AGGGTCTAAACAAATAAAAACTCAAAGTACACGAA CCACGAGTCTTACAT[A/G]CTGTGTTATGATCAC CTCATTTCCCTATTTAGACTCTAAAGTTCTTTCCA
solcap_snp_c2_3153 PGSC0003DMB000000596 73128 TTATTCAACAATGGACTAAGTTGTGGAGCTTGTTT TGAGATCAAATGTGA[C/T]AATCAACCACAATGG TGTCATCCTGGAAGTCCTTCCATTTTGATTACTGC
solcap_snp_c2_3154 PGSC0003DMB000000596 51186 TCTCCTACTAAATCTCTTGCTTACAGCAAGAATGG AGAACTAACATAACA[T/C]TTTAGATAAGTCTCA AGTTTTAAGCTGTGCATGATTCTGATTACCAGAAC
solcap_snp_c2_3155 PGSC0003DMB000000596 50550 CAGGTTGAAGATCGTGGGTACCGTGAACATCCCCA TTTGCATGGAAGGGG[A/C]TTGATTACATCTACT TTGATTCCATTAGCCCCTCTTCAACCTTTACCACC
solcap_snp_c2_3158 PGSC0003DMB000000266 55585 GCCTCAGAGGATGTATTGTCTTGTTTCCATTTAAG ATCTTCGTTAGGGTC[T/G]TCATAAGAGTCGTCC AGATCAGAGTTCTCCAACCCATATTGTGATGTACC
solcap_snp_c2_3160 PGSC0003DMB000000821 58945 TGTCATAGAGTTGTATTGGCACCATTATCAAGGCA AAGATCTTATGGCAA[C/T]ACTCCTCAACCACAT GCTATACTTTACTACTCACAAAGAACTACAAAAGG
solcap_snp_c2_3161 PGSC0003DMB000000821 58947 TCATAGAGTTGTATTGGCACCATTATCAAGGCAAA GATCTTATGGCAACA[C/T]TCCTCAACCACATGC TATACTTTACTACTCACAAAGAACTACAAAAGGTG
solcap_snp_c2_3162 PGSC0003DMB000000266 252673 GGCGTCGAAATCAGCGATTGAATCGATGCCGATTA TTCAAATAGCTTGTA[A/C]TCACGTAAATTCCGA GACCCATTGCGCTGTTTGTAAAGAAGCTTTCGATT
solcap_snp_c2_3163 PGSC0003DMB000000266 280742 TGATTTCTTGAAACAATCCGAATCCCCCCAGTTTA ATATGGCTTCTACTG[C/T]TCAGTCTGCGAAAGT ACCATATTCTGTTGCTGTTACTGGCTCCGGTAGTT
solcap_snp_c2_3167 PGSC0003DMB000000266 281231 CTTGGACAGGAACTATATGGGTAATTCATATGTGG ACTTGCTTCAGAAAG[C/T]TTATCTCAGTAATGT GCTACCTCAGAAATCTCAATATGGGGTTCCATTGA
solcap_snp_c2_3175 PGSC0003DMB000000337 361566 CTTGGAGATGGATCTCTTCACAGTGGTATCAGTTC TTCGGAGCTCATTCT[G/A]CGTAGAAGGAAAGAT TCAAGAGGATTTATCACCAAGGGTGATTCTTGACG
solcap_snp_c2_3185 PGSC0003DMB000000056 244260 GTATAATGAAGCCCACGACTCTCATGTCGGGAAAG AGCACTGCTAACAAC[C/A]AGCTTGGCACAACAG AAGAGATTCCTCATCTCGCAAGCCTCTAAACCAAC
solcap_snp_c2_3191 PGSC0003DMB000000056 210487 ATCAGATCAAGAGCAAGAGCTCCAGGAATGGACAC TTCATCAACTGAAGC[A/C]GATATGTTGCAGGTG ACATGGTCAAACAAGCTCCGTTCTTCTTCGGTTGT
solcap_snp_c2_3204 PGSC0003DMB000000124 210014 AGCTTTAGGAGGGTATCTAGTTTGAACGCATGTGC ATCACCCCGATTTGT[C/T]CCAACATTCATGCGG TTACCAGTCTTCAGCACTGCTTCCAGAAGCTTTAA
solcap_snp_c2_3205 PGSC0003DMB000000124 209801 GAATCCATAGCAGCAGCTTTCTTAACATTTACAAC CTCTGAACTAAGGTT[G/T]GAAACAACTTGGAGG CCAAGCTTCCGGCACTTGACGTCATCATTCATGGC
solcap_snp_c2_3220 PGSC0003DMB000000124 1253 GGACGAAAAGGAAGTGGGTCTGGTAGCGATTTGGA GATGGAGATTCGTGG[C/T]TGAGCTGTTGTGTTG TTATTTGGTTGTTGTTGGTCGTTTTGGGTTGTTGA
solcap_snp_c2_3220 PGSC0003DMB000005673 415 GGACGAAAAGGAAGTGGGTCTGGTAGCGATTTGGA GATGGAGATTCGTGG[C/T]TGAGCTGTTGTGTTG TTATTTGGTTGTTGTTGGTCGTTTTGGGTTGTTGA
solcap_snp_c2_3224 PGSC0003DMB000000124 8568 TCAACAACCCAAAACGACCAACAACAACCAAATAA CAACACAACAGCTCA[G/A]CCACGAATCTCCATC TCCAAATCGCTACCAGACCCACTTCCTTTTCGTCC
solcap_snp_c2_3224 PGSC0003DMB000005673 415 TCAACAACCCAAAACGACCAACAACAACCAAATAA CAACACAACAGCTCA[G/A]CCACGAATCTCCATC TCCAAATCGCTACCAGACCCACTTCCTTTTCGTCC
solcap_snp_c2_3255 PGSC0003DMB000000056 276639 AACCTCAGGCTCATCCTGAAACAGTTTGCCATTCA TCTGATCCCTCTCAA[G/A]CTCTTAATCACCTGC AAACAAGTGACCATGAAGAGGTGGAAAACACTGCT
solcap_snp_c2_3260 PGSC0003DMB000000409 329726 AGGGCCATCATATCATAAATTAGGTATCTCCTTTC CTGCTTCTGTGTGTC[A/G]GGCAAAGTATCAATT ACCATCTCTCCATCAAGTAAAGTGAAGTGGTGGGT
solcap_snp_c2_3260 PGSC0003DMB000000196 944433 AGGGCCATCATATCATAAATTAGGTATCTCCTTTC CTGCTTCTGTGTGTC[A/G]GGCAAAGTATCAATT ACCATCTCTCCATCAAGTAAAGTGAAGTGGTGGGT
solcap_snp_c2_3305 PGSC0003DMB000000409 76363 TCCAGTTTGGTAACTACAATACTATGTGTTGAGTC AGGGAAGATTCAAAG[T/C]TCAGTCCTTGTTGGT CAAGAGCAGTGAGGATTCATATAGCCGTCTCCAAC
solcap_snp_c2_3318 PGSC0003DMB000000627 198982 GAATGCTCCTTTGGTCAGCATTTCTACTTAGTGGG CGATGATCCAATGCT[C/T]GGTTTATGGGATCCA TCAAATGCAGTGCCACTTGAATGGTCAGAGGGACA
solcap_snp_c2_3320 PGSC0003DMB000000627 198497 GTCGCGGAAAATATCACTGAAGTAAACGAGGATGT GAACACTGGTGGAAA[T/C]GAGGACACCACAATG GAAGCAAAAGCTATTGGCAAGAATATGGTGTCCTC
solcap_snp_c2_3321 PGSC0003DMB000000627 198489 AAATATCACTGAAGTAAACGAGGATGTGAACACTG GTGGAAATGAGGACA[C/T]CACAATGGAAGCAAA AGCTATTGGCAAGAATATGGTGTCCTCTATTGATN
solcap_snp_c2_3323 PGSC0003DMB000000627 197357 CAGTGGAAGAGAATGTGTTTGTAAGTGATATGCAA AAGAGTAAAAAGACA[C/T]TGTTGAAGTTCTTTG CAGGTTTGGGTTTCTTTAAAGTAGAGCTTGAAGGC
solcap_snp_c2_3345 PGSC0003DMB000000627 169527 CTAAGTTTCCATTTCCTATAGTACTCTGCTTTGTA TTCCTCTGCTTCTCT[G/A]ATTATTTCCCTAACA ATTTCTTTCTCCCTTTTCTCCTTCTCCTCCAGCCG
solcap_snp_c2_3346 PGSC0003DMB000000627 169525 ATCTAAGTTTCCATTTCCTATAGTACTCTGCTTTG TATTCCTCTGCTTCT[C/T]TGATTATTTCCCTAA CAATTTCTTTCTCCCTTTTCTCCTTCTCCTCCAGC
solcap_snp_c2_3351 NM NM NNNNNNNNNNNNNNNNNNNNGATACTCATATATCT CAAATTTCTTCATAT[A/T]CTCACCCTTTGGAAT CTCGCCACAAAGTCTATTATAACTCACATTCAAGA
solcap_snp_c2_3352 PGSC0003DMB000000627 162208 CTCACCCTTTGGAATCTCGCCACAAAGTCTATTAT AACTCACATTCAAGA[T/G]TTGCCACGGATTCTT GGCTATTATTTTTGGAATACTCCCATAAATCTTGT
solcap_snp_c2_3353 PGSC0003DMB000000627 162045 GAGACAATTGACTTGTCAAGGAATATGCTTGAAGG GGATATTTCATTTTT[A/G]TTTGGTAAAGATAAG ACTACATTTCAAATGCTTTTGGATCGGAATAAGTT
solcap_snp_c2_3358 PGSC0003DMB000000627 128612 TCTAGCTCCACCATGGCCACCGCCGCAGCTACATC CTCATTCATCGGAAC[A/T]CGGCTGCCGGAAATC CACTCCGGTGCCGGTAGAGTCCAAGCCCGATTCGG
solcap_snp_c2_3363 PGSC0003DMB000000627 53924 ACATCCTAATCTAGCATTCTACATTTAAGGAAAAG TAAAACACAAGTCAT[C/T]AAATAGAAAGAGCTT TGTTTGCTCTAAGCAGCTTGGCATCTCCATGGGGG
solcap_snp_c2_3368 PGSC0003DMB000000627 19770 AGTCTTCATAGATCACTCTTATTGAATAATAAGGT CTAGCATTCATCAAA[T/C]CTTATTTTCCCCTCA ACATCCAAATTCTAGATATATCTCATGGTGGAGAA
solcap_snp_c2_3449 PGSC0003DMB000000072 371884 TCATTCATAGCTGTAAACACTTTATCAAATACTTC ACCAGGAGATAAAAC[G/T]TTTTCACCTGTCAAA TACTTAGCACCTAATTCTTCCCTCACAAATTTGTA
solcap_snp_c2_3451 PGSC0003DMB000000072 373003 CTTTCTGAAGTTTTATCAGCAATATTTGCTGAAGT TATGCAAGGAAAGCC[C/A]GAATTTACGGACCAT TTGACACACAAATTGAAACATCACCCTGGCCAAAT
solcap_snp_c2_3452 PGSC0003DMB000000072 373324 GGTACCAAGTCACCAGACGCTGTGATCGTGCCACG TAGGGGCAAACACGG[G/A]GTAATGTTGTTGTTC AACAACTTTGTTATAGCTTCCAAAATCTCAAACCT
solcap_snp_c2_3512 PGSC0003DMB000000072 592410 TTCTACAGGCCAGATGAAATTCCACAAGGATTTTC GATCGTTGGCCACTA[T/C]TGTCAGCCAGATGGT GAGAAGAACATAACAGGCTATGTTCTTGCTGTCAA
solcap_snp_c2_3603 PGSC0003DMB000000072 924829 CCAAGCTTCCACTACATGAGTTTGGTTTTATTGTG GCACGGAGTGATGAG[C/A]TTGCTCTATTCAAGT GGCTGCAGAATAGTCTCATTCTAGAATAGAACAAG
solcap_snp_c2_3679 PGSC0003DMB000000101 1403958 CTTTCATTTCAAGTCCGAACAAGTTCAATCTTGGC GAAGTCAAACTCTTT[A/G]CTTTGTTATGAACGT TGTTTTAAAGCTAGAAATTGCGGGGACTGGAGGTA
solcap_snp_c2_3680 PGSC0003DMB000000101 1403994 AAGTCAAACTCTTTACTTTGTTATGAACGTTGTTT TAAAGCTAGAAATTG[C/T]GGGGACTGGAGGTAT AAGCAGATAAAGGGTTTAAAAAAGCTGCAAGATTG
solcap_snp_c2_3681 PGSC0003DMB000000101 1404292 AGCAGGAAAATGGAGCTAGGCCTTTCAGTGAAGGT TTTAAAACTGCTGCC[T/G]CAGTTAATAGTAGGC CTAGAACTAACACGGAGTCTATTGAGGATGAAGCG
solcap_snp_c2_3682 PGSC0003DMB000000101 1405440 GCCAGCTTCAAAGTGCGTACAATTCCACTTGATAA TGACGAATCTGCAAC[A/T]GAAGATGTACTGGAT CCAGACTTCGGCGAGGCAGCAATTGGTCGAGTCGC
solcap_snp_c2_3683 PGSC0003DMB000000101 1406722 ATTTATAGATACAAAACGGAGGAATATTCATACGA TGCAATCAATAAGTT[T/C]AATATATATCCAGAT CAAATTCCTCCCTGGCTGGTGGAATGGATGCCTAG
solcap_snp_c2_3684 PGSC0003DMB000000101 1406788 CAAATTCCTCCCTGGCTGGTGGAATGGATGCCTAG TGAAGGGGGTTATCT[T/G]ATAGGAAACCTGCAG CCAGCTCACATGGATTTCCGGTTCTTTTCACTTGG
solcap_snp_c2_3685 PGSC0003DMB000000101 1406862 CATGGATTTCCGGTTCTTTTCACTTGGGAACGTTT GGTCCATCGTAAGCA[G/A]TCTTGCTAACATAGA TCAGTCACATGCCATTTTAGATCTTATTGAAGCCA
solcap_snp_c2_3686 PGSC0003DMB000000101 1408491 GCACGTCTCTTTCAGACATGGACTATTGCAGGATA TCTAGTGGCAAAGCT[G/A]CTTATTGCCAATCCA GAGGCTGCAAAGATGGTAATCAATGTGGAGGATAC
solcap_snp_c2_3691 PGSC0003DMB000000101 1414367 GTGTGTCTTGGAAATATATGCAGAAGTCCAGCTGC TGAAGGTGTTTTTAC[G/A]GATTTGGTTAAGAAA AGGGGGCTTGATTCAAAGTTTAAGATTGATTCTGC
solcap_snp_c2_3737 PGSC0003DMB000000392 480651 TTTGTGCATACAACATGTTGTCATACTTCAAATTC GTGATCGGGTCAGTC[G/A]TACCTTGGTTAGGCT GGAAAAGTACATAATCAAGCGGAACTTCGTTGGGG
solcap_snp_c2_3738 PGSC0003DMB000000392 480503 TGAAACAAATTACCGTTATATAGTGCAGCATTTAC AGGTGTTGCTCCAAA[C/T]TCATTCGGGTCTCCC TTTGATGGCCAGCCGGTTTCGGAAACCTTAACTGG
solcap_snp_c2_3739 PGSC0003DMB000000392 480365 TCGGAGCCCATTGATGTTTACGTGTTTGCACTTTT CAACGAAAATTTAAA[A/G]CCTGGTCCAGCATCT GAGAGGAATTATGGTCTCTACTACCCTGATGGAAC
solcap_snp_c2_3740 PGSC0003DMB000000392 480350 GTTTACGTGTTTGCACTTTTCAACGAAAATTTAAA ACCTGGTCCAGCATC[T/A]GAGAGGAATTATGGT CTCTACTACCCTGATGGAACTCCAGTTTATAACAT
solcap_snp_c2_3747 PGSC0003DMB000000392 452769 TCTTAGTCGTGCTGTATATCCATTGTTAACCTCAT ATGCCTCACCGGATA[A/C]GCAAGCATATCCTCG ACATTCCCTGAGCCGAGCTGCGCTGATTACAAGTG
solcap_snp_c2_3753 PGSC0003DMB000000392 435696 TTCAGCAGTTGTAAAATGTACACCAGTTCTGGGGA TTTTTGTACATCCAG[A/C]TGGTGGAGAACCATA CAGAAGGAAAAGAGATTAGGGTACTGTTTTCGAAA
solcap_snp_c2_3805 PGSC0003DMB000000392 337668 GATCTTATCAATCTATTCCGACGTCCTCCATCCCG GAAAGTGAAAGCTGT[T/C]TGATTTCTTGAGGTG GGATATGTTCACACTTGAGGTTTCCAGTAAACTAT
solcap_snp_c2_3823 PGSC0003DMB000000101 487267 AGTGCCCTGGATTCAGAAGACATGGAAGAGGAAAT TGAAGAAGAAGTTGA[A/C]AAGGTCTTGACTGCA ATTGCTGGTGAAACCACTGCACAACTACCTGAAGC
solcap_snp_c2_3828 PGSC0003DMB000000055 768348 ACAAACACAACGCCAGCTGCTTGAGGCAGGAACTC ATCTAGTTTCGGCCT[C/A]AGACGAGAGTGCCCA GGGACATCAACAACGTGAACAGGCTTCAATTTTCC
solcap_snp_c2_3828 PGSC0003DMB000000101 574145 ACAAACACAACGCCAGCTGCTTGAGGCAGGAACTC ATCTAGTTTCGGCCT[C/A]AGACGAGAGTGCCCA GGGACATCAACAACGTGAACAGGCTTCAATTTTCC
solcap_snp_c2_3841 PGSC0003DMB000000101 649702 TCTAAAAGTGATCAGGAAGGCAAGGGAATGAAGAC GACTAATCAAAGATC[G/T]CTTTGTCTAAAAATG ATCAGGATGACGATGAAGAAGTCTACTCAAAGATT
solcap_snp_c2_3873 PGSC0003DMB000000101 915338 CACCATCACTATTCCCATCCTTGTCCCCGCGCAAA TCCTTCGTCCTGCCC[A/C]AAATGGAATTAACTC AAAATCGTTCCCACGAGGTTCAATCTTTGCGTTTT
solcap_snp_c2_3934 PGSC0003DMB000000177 1098297 GAACAATAGAGGGTAAAACAAGAAATAGTTTGGAA TATATACCTTGGAAT[A/C]TTGAACTTATTAGCA ACTTGTTGAGTCCAAGTGAGAGGACTAGTAGAAAT
solcap_snp_c2_3943 PGSC0003DMB000000177 932821 AAACAGCACCAGAAGGAAATTCTAGTTTCCCATGA CCATGTGTTATCCCA[T/C]GTCTCCACTCACCCA CATACCGACAACCATCAGACCACCTATACTTTCCA
solcap_snp_c2_3944 PGSC0003DMB000000177 932682 AAAATATCCCCATTGGGATACATTTGATATCCTAA ACCATGTTTAAGGTT[C/A]AACCGCCAGCGTCCC CTATAGATCACTTTATCAGGTCCAATATATGTCCC
solcap_snp_c2_3945 PGSC0003DMB000000177 932639 CTTACCTGGTCCTTCAGGGGTTCCCTGCATCCAGG ACCCTTCAAAAATAT[C/T]CCCATTGGGATACAT TTGATATCCTAAACCATGTTTAAGGTTCAACCGCC
solcap_snp_c2_3946 PGSC0003DMB000000177 932496 GTATACATACCGACGCCATGCATTGCACCATTTAA CCAGTTCCCTTCATA[T/C]GAATCTCCGTTAATC CAAGTGAGAGTTCCTTTCCCTGATATTTTCCCTCC
solcap_snp_c2_3947 PGSC0003DMB000000177 932485 CATCACTCCATGTATACATACCGACGCCATGCATT GCACCATTTAACCAG[T/C]TCCCTTCATATGAAT CTCCGTTAATCCAAGTGAGAGTTCCTTTCCCTGAT
solcap_snp_c2_3948 PGSC0003DMB000000177 932328 GAGACTTGACTTTGTTTTCTCATATCTGGCAGTAA CCCTCGTTTTCTCAA[T/C]GCATTGAGGTACAAT TCTTGACCAGCCGTAAGCCTGCTACCACTAGGATA
solcap_snp_c2_3949 PGSC0003DMB000000177 932127 ATTGGAGCACTCATAGCATCCTCCATGTCTCCATC TAAATTATGTCCAAT[A/G]ACTTTCTCAATGGCT ACTTCAAGACTCCATCGTCTTTCCAGAGAAACATT
solcap_snp_c2_3950 PGSC0003DMB000000177 932088 TCACTGATTAGGATGCCTTGCATGTACTCTCTTTC CAAAATTGGAGCACT[C/G]ATAGCATCCTCCATG TCTCCATCTAAATTATGTCCAATAACTTTCTCAAT
solcap_snp_c2_3951 PGSC0003DMB000000177 924410 TAAGGTTTAAATGGACAAAAACCACAAACTCAAAA ATCACTACAAAAGAC[A/G]AATTTAACTGATGTC GTCCATGCATTAAAGGTAGGTTCAATGACTTCGGT
solcap_snp_c2_3952 PGSC0003DMB000000177 924277 GGCGCATTCCTTGGCCTTGCATCTGTTGACCTGGA AAACCTTGTGGAGGC[A/T]TCATTGGAGGTCTCC CCATGTGTCCACCTGGAGTGAAATTAGCCATTGCT
solcap_snp_c2_3953 PGSC0003DMB000000177 924131 GGTGGCATAGGTCTAGGTCCGTTACCCATAGGGGG AGGGGGTGGAGGCAT[C/T]GATCCAGGGGCAGAT GGTGGGCCTCTGGGTGGAGGATTTGGAGCTCCAGG
solcap_snp_c2_3959 PGSC0003DMB000000177 855872 CCTAAATCCATCTCTACATAAAGCAATACAGAGAG AGATTACGTGAAAGA[G/A]TAAGTAAAGAATGTT CGACAACTCCCTTGTTGCAAGCAATGACATGTAAA
solcap_snp_c2_3961 PGSC0003DMB000000177 843499 CAGTGTCTATAAGTAGCAAACAGGAAAAACACCAT TACAGCAACGATTAA[G/T]CCATAAAGCATAATC GTAGGGACACTAATTCCACTTGGCCCCTTCTTCTT
solcap_snp_c2_3962 PGSC0003DMB000000177 836664 GGTAGCAAGTCGTGTCATGTCAATATTGAGGATTT AAAATCAGCAAATGA[C/T]GGTTTCCAATCCAGA CCCCAAGTAAACATTTGTGCTGCAGACGTCGTTCA
solcap_snp_c2_3969 PGSC0003DMB000000177 832732 CTGTTAAGGCAACGAGCAACCTGACGAAAAAGAGG AACCATGCAGCGCTG[A/C]AATTCAGCAGCTTGT GTGGCTTCCAGAACTTCTTCAAGTTCCCCAAGAAA
solcap_snp_c2_3984 PGSC0003DMB000000177 692990 AGTCCAAAATTTAGAGGCCTATGCAAGCCAAGAGC AACAACCAGGGCAAC[T/G]AGGATGGTCACTTGA TTTTGGAGAATGCACCAGGGTGAAATTTTTGGCAC
solcap_snp_c2_3997 PGSC0003DMB000000177 594973 TTACTCTTGCTGTAGTTCCACTTATTGCTGTAATT GGGGCTATCTACACT[G/A]TGACATCAGCCAAAT TGTCAAGTCAAAGTCAAGAAGCACTTTCAAAGGCA
solcap_snp_c2_4030 PGSC0003DMB000000021 2481446 TTTGTTGAAGTCATGAAGGAAGCTGGAGTCCTTCC CGGTATTAAGGTTGA[C/T]AAGGGTACCGTTGAG CTCCCCGGGACCGATGGTGAGACCACCACCCAAGG
solcap_snp_c2_4031 PGSC0003DMB000000021 2482128 AGAAAGCACAAGCTGCATTCCTTACCAGGTGCAAG GCCAACTCCGATGCT[A/C]CACTCGGAAAGTATG CCGGAGCTTCCAACTTAAGCGAGGGCGCTTCCGAG
solcap_snp_c2_4034 PGSC0003DMB000000603 162531 ACTTCCAAACATTCTGTGTCATATCCAGTTAGTCT GCCCCCATCAGCAGC[A/G]CCTTTACCTAGCAAG GAACCTTCCAGGGAGCATGTTGGATTGCAATACGG
solcap_snp_c2_4045 PGSC0003DMB000000021 2572958 GGGAGTTTGAGTTTTAATGGAAATTTAAGTAAAGA AGATGAAGAAATGTC[A/G]AAATCTGCACTTTCA ACTTTTAAAGCTAAGGAAGAAGAGATTGAAAAAAA
solcap_snp_c2_4048 PGSC0003DMB000000021 2608801 ACAACTACAAGAAGGTGGTAAACTGGAGGAGTCTA AAACATTAAATACTT[T/C]TGAAGAGACAATTAT TGATGAATCTGATAGGATCAGAGAGAGGGGCATCC
solcap_snp_c2_4127 PGSC0003DMB000000603 193759 TTTGATTATTGAGTAGATGAAGAAGGATCTCCACT GATGGTGGAGGCACT[C/T]GTGGGTTTGTGTTCG CTACACAAAATTCCTTGTAGTTGTTTCCGGAAGTC
solcap_snp_c2_4136 PGSC0003DMB000000021 2858744 TAATAAAGCAGTCCTAATGATTCCTCAAAATTACA ATCAGCACAGACAAG[C/A]ACAAAACAAGGAATC AGCTAAGCAGAAAAGAACTATAGTCAAGTTTTGGT
solcap_snp_c2_4156 PGSC0003DMB000000021 2951776 TTATTAGCGTAAACTCGTTTTTCGCTAGAATAACT ACTCCTCCTCTTCCC[G/A]CACTCACTTCCTGAC ATTGAAAAACTCTGAGTTCTTGAATACTTCCCACA
solcap_snp_c2_4157 PGSC0003DMB000000021 2951938 AGAACTGCCTTATAAACAGTACCTAAACACCCTTT ACCAAGCATCTCAGC[C/T]GATGCTCTTAACAAT TCCTCAAGCTCAAATGGCTTCCTCCTATCGAAAAA
solcap_snp_c2_4158 PGSC0003DMB000000021 2953363 GCCACGATGATCGAAAATTAGTAACCGGGGAGTCC ATCTTCAGTGGTGGC[A/T]AGGGAGGGGGAAAGA GAATTGCGCGATTCGTCATAATCTTCACCTAATGG
solcap_snp_c2_4165 PGSC0003DMB000000021 2981391 CCTGGTGTTAGTGCTGACAACAATAGTACTGATGA TGGAAAAAGGAATGG[T/C]AATAAAACTTGTCCT TGGCAAAGAATGAAGTGGACTGATAACATGGTGAG
solcap_snp_c2_4174 PGSC0003DMB000000021 3023080 GGTGGAAAACGTTAAGCTATTGTTTATGTTGTTCT CTAAGTAGTGCTAGA[G/T]TGATTTTGCATCTTG ATTGAGTGTAGCTATTCTGATCCACCAGCGTTTAG
solcap_snp_c2_4187 PGSC0003DMB000000679 109182 TTTGAACTATACAATATTAACATATTTAGGGACAT TTTCCTGGTAAAATA[T/C]CAAATCAGAAGCAGA TCTCTTAGTATTCTCAAAATTCATACAATAGGCTG
solcap_snp_c2_4192 PGSC0003DMB000000679 81155 ACACTATGTGTGAAAAAGTAAGATTGAGACTTGGT CATGATTTCAGGACG[C/T]GAGTAGGAAGAGACA GGCGCACTAAGATTATGCTTTCCAAGAACAAGCTT
solcap_snp_c2_4196 PGSC0003DMB000000603 240066 GATGCCTTCTGAATGGCATCTATAGAATACACCAG GGCTTTTGAAGACTA[C/T]GGAGATATACATGGA CAATCTGCTGCATTTTTAATCAATTTATGAATGCA
solcap_snp_c2_4197 PGSC0003DMB000000603 240113 CTACGGAGATATACATGGACAATCTGCTGCATTTT TAATCAATTTATGAA[T/C]GCATCGGCAATGGTA TTTGCGACTCCACAACAGAGCAATTTGAAATATCC
solcap_snp_c2_4200 PGSC0003DMB000000053 558329 AAGTTCTATTGAACTGTTGCTTTGGCAGGTGGTGA AAATGTATTAACAAG[T/C]GTCTTTTATGAGACT TACCTTTTTTGAGCTTCTGCTCATTAATTTTCTTC
solcap_snp_c2_4205 PGSC0003DMB000000053 731429 TTTCAAAAGATGGGAAAATGGTGGGTTCGAGTGCA ATTGTTGGATGGGTA[A/G]GCAACGATGGGTCTT CCACCATGAAAAGGTATTTTCTAGGTGGAGAATCA
solcap_snp_c2_4214 PGSC0003DMB000000031 1467968 AGCTCTGATCCACCGCCTAAGATAAGTGTTGCAAG CTTCTTCCAGATTTA[G/A]CAGTCTGACTGACCC CAGATCTTCCCATTTTGTTAGTTGTAATAGCTTAG
solcap_snp_c2_4225 PGSC0003DMB000000137 855744 TCATCTGTCAGTGATGATTTAACCACACGACTTAG TTCAGGGAGATTGCC[C/T]GCCCTTGCTGAACAG ATGAGCATATATGATGCCAAAGTAAATAGAGACCT
solcap_snp_c2_4227 PGSC0003DMB000000137 862304 GACCAAGTAAAAAATCAGTGTGAGGCCCTTGTTAC TGGTAAACAACACAA[G/A]ATGTCATCCCTTCAG AGTTTCAAGATGCAACAGGAAACCAAGGCATTAAT
solcap_snp_c2_4230 PGSC0003DMB000000237 141439 AGGCACAGCACGAGCAAATCTGTCAGATTTTGAAG CATCCTTTTCTGAAA[T/G]TGGATTTCCTTCACT AGCTTGTTCTTGAAATGCAGGACCAGCGTTGCTGT
solcap_snp_c2_4240 NM NM CTTTATTGTTGGCATTAACAAAAAACAACCCTATA ATTTGTACTATCACT[G/A]GGGCAAGTAAAGGTG CTAGTTGCATCGTCTTGTGGGTAGCTATAGGCATC
solcap_snp_c2_4241 PGSC0003DMB000001509 6693 GGTAATTTTTCATACCATTTGTAGCAAACTATGCT TTATTGTTGGCATTA[A/G]CAAAAAACAACCCTA TAATTTGTACTATCACTGGGGCAAGTAAAGGTGCT
solcap_snp_c2_4241 PGSC0003DMB000002986 815 GGTAATTTTTCATACCATTTGTAGCAAACTATGCT TTATTGTTGGCATTA[A/G]CAAAAAACAACCCTA TAATTTGTACTATCACTGGGGCAAGTAAAGGTGCT
solcap_snp_c2_4268 PGSC0003DMB000000137 9722 CTTCACTGCCCATGGCTCCCCAGAAGAAAATGAGG GTAACCCTTCAGTAG[G/T]TATCCTGATACCAGG GAACATTAAATCTGCCCCTCCGAGCATAAAACGAG
solcap_snp_c2_4273 PGSC0003DMB000000137 12998 ACTATTTCAGAGGCTTCAGATGCAGTGTAAAGTCT ACTAGTTTCAGCACC[A/G]ACAGAAGCAAAAATA GGATTTACATGCACACTTGGTTTATAAATTTCAGA
solcap_snp_c2_4275 PGSC0003DMB000000137 13088 TTAAATAAAGCATCGCATAGAGTTGCATCTAACGT CACAGTGGACTTATT[C/T]GACGGCTTGACAAGA TTTTCTTTCTCAACGTACTGGAACACTATTTCAGA
solcap_snp_c2_4276 PGSC0003DMB000000137 13257 TTGCCTCCGCTCTGTCATTATCTGGATTGGCTTCA AGGCTCCTTTGCGAA[C/T]AACTGTATCGTTTCC TCTAGTCACACAATGATGTGCTTGCATCCTACCAA
solcap_snp_c2_4280 PGSC0003DMB000000137 86983 AGCAGTTTTCACTGTCAATTTCTCTGAACTTGATA CATGTACAGAAATGC[C/T]GGAATCGTTGAAGTT TCATTTACCATTTAAGAATACACTGATTTCTATGT
solcap_snp_c2_4315 PGSC0003DMB000000137 671196 TCAACACAGCAGCCTCTTTTTCCCAAACAAACAAC TGTGGAATTTGCATC[A/T]CCCTTGCAATTAGGA GGGAGCCCAGGGACAAGGCCTCCCATGTCTAATCC
solcap_snp_c2_4316 PGSC0003DMB000000137 671215 TTCCCAAACAAACAACTGTGGAATTTGCATCACCC TTGCAATTAGGAGGG[A/T]GCCCAGGGACAAGGC CTCCCATGTCTAATCCGTCTGCAAATACTAGTAGT
solcap_snp_c2_4342 PGSC0003DMB000000022 2164818 TGTAATATTATTTAGTCAAGCTTTCAATTTCTCTT TACAACTTAGTAACT[G/A]TGCTATGCTTTTTCC CCTTTCGTTCGGCAACTACTCGTACAATGTATATG
solcap_snp_c2_4344 PGSC0003DMB000000066 959876 TTTGTTCATCGACAATGGCTCTTCAGATTGCGAAA AGACTTCTTCGGAGC[C/A]CTGCTAATTCAGCTG CACCGTCTATTAGGTTTTTGGATCGGAGCTTCACT
solcap_snp_c2_4354 PGSC0003DMB000000066 685668 TGCACAATTTCAGGAGTGCATTGATCAGGTGGCAA CTCATCAGATCCCAT[T/C]ACTGCTTGAAAAAAG CGGTGCCTTCTCTCTTCATCTTCCTCCCACCAAGC
solcap_snp_c2_4358 PGSC0003DMB000000066 489841 GAGGAATAGCACAAGGTTGAACTAAATTAAATTCC CTTATTGAGTTGGAT[T/C]AAAGTTTTTGCTTTA CATACCAAGGCAGGTGTTGTGCAGTGAGCAAGTTT
solcap_snp_c2_4366 PGSC0003DMB000000066 2097001 TCAAGAGAGTCCCAACTGATATGTTTGTTGACAAT CAGACCTTGAAATCC[A/G]GTGCTTTGATCCACT TTCACAATAAGTACTTTGGATCCATCAAACGGGTG
solcap_snp_c2_4372 PGSC0003DMB000000066 1650175 GTGTGACTGGCATTGACACATCAGCTAGTCATCGT GGAAATCATTTCTTC[A/G]TCAAGAGGAGAAGTG ATGAATGTTTCAATTCAGAATTACTTGCATGCCCT
solcap_snp_c2_4381 PGSC0003DMB000000615 232145 ATGCTAATTCCTCATATATGCTTATGCTTTTCCTT AACATAACATGCATC[A/G]CTATACTCATTGCAT CTCCAAATCTAATCATCTTTACAAGTTTCTCTTTC
solcap_snp_c2_4383 PGSC0003DMB000000615 232260 ATGGAGGACATATGTGAGTAGTGACGACTAGACAT TGAATTGGACCTTGG[T/C]AAAACAAACATACCT GAAAATCGAACAACTGAATTAAGAATCCATAATAT
solcap_snp_c2_4385 PGSC0003DMB000000615 232430 TGATGTAAGTTAATTGCCTCTCGATCGATCTCTTG TTTCCATATGTGGAA[G/A]ACTTTTGAGCTAAGA ATAATGATCATTTACATCCTCTTTATTACTGTTTG
solcap_snp_c2_4387 PGSC0003DMB000000111 274270 ACTTTAACTTCTTCTGTAGCTTCTTCTACCTTCTT CAAGATTTCTGTTTT[T/C]GACACATCAGCTTCA TCCACTAGCATCATTGCATCTACTTCTCTTTGCTT
solcap_snp_c2_4391 PGSC0003DMB000000111 274733 AGAGATCTTAGCAAAACCAAACTTCTTCCTTTTTG TAGGGAGATGATGCT[C/T]AAGTCCATTCTCTTT CTCATCCTTCCGACTTGATTGCAACTCACCAGTGG
solcap_snp_c2_4393 PGSC0003DMB000000224 985430 CCTGAAGAGGCAGCGATTGATGATGCAGGTTTTGG TATCGGTGAGAGTAC[T/C]GACTCAATAACAGAA GCAAAGCCAGAACTGGTCAAGCCTGCACACTTGAA
solcap_snp_c2_4394 PGSC0003DMB000000253 62528 CAAAAAGATCTCTAATTTGAAACGTTTTTGAGGTT GGAATCGAATTACTT[T/C]AGGGCCATTTGCTCA TGCTTGTCAAAGTTCTACAAAGCTGAATCTTCCAG
solcap_snp_c2_4400 PGSC0003DMB000000253 126981 CCTAAAAAGTCTTGGCAACAACTATTCACTCGATC ATCTACTGTTTCTCC[A/C]CCCTCTTCAAATGTA ATCAGCAGACCAAGTGTTAAGCCTCAACCAGAAAT
solcap_snp_c2_4407 PGSC0003DMB000000064 129616 ACAAAACATGCAGATAAAATAGAAAATGTCCATAT CTGTAATAATTAACC[A/G]GGAAACATAATAACA AAGAGGGAAAAGAAATTGACCGACTGTTATTCACG
solcap_snp_c2_4408 PGSC0003DMB000000064 129608 ATGAAGATCGTGAATAACAGTCGGTCAATTTCTTT TCCCTCTTTGTTATT[T/A]TGTTTCCCGGTTAAT TATTACAGATATGGACATTTTCTATTTTATCTGCA
solcap_snp_c2_4409 PGSC0003DMB000000064 128886 TCTCTTCCACCACCAAACCCCCACTCTAAAACAAC TTCCTCAAACCCACC[A/G]GATAACCACCCAAAA CAGACCCATTTTTGCTCTTCTTCTCCAACCATTTC
solcap_snp_c2_4410 PGSC0003DMB000000430 183253 TGTATTATACTTCATAGCCTCTATTGTTGGAACTT GAAAATGAGGATTAT[T/C]CTTAACCAAAAGATC TTCTTCTTCCTCTTTATTACCTTGCATGATGCATA
solcap_snp_c2_4411 NM NM GAAGAAGCTGTGGAGTCCTTTTGCAATGGGGTTCA TCTTTATGGACCATT[T/C]TTTGAACATGTTCTT GAATATTGGGAAGAAAGTAAAAAAATGCCTCAAAA
solcap_snp_c2_4412 PGSC0003DMB000000015 2042426 GTATGTTGAGCTTGTCCGAAATCCTTGACCTTGTC ATATGGTTGGTTACT[G/A]ATTCATCATGACATT TCAACTTTTGGCTTTAAAAAATGATTTATTGTCGT
solcap_snp_c2_4412